Basic Information

Symbol
GNAI3
RNA class
mRNA
Alias
G Protein Subunit Alpha I3 87U6 Guanine Nucleotide Binding Protein (G Protein), Alpha Inhibiting Activity Polypeptide 3 Guanine Nucleotide-Binding Protein G(I) Subunit Alpha-3 Guanine Nucleotide-Binding Protein G(K) Subunit Alpha G(I) Alpha-3 Guanine Nucleotide-Binding Protein G(I) Subunit Alpha Heterotrimeric Guanine Nucleotide-Binding Protein 1A ARCND1 ARCODS HG1A
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_006496.4
Sequence length
9044.0 nt
GC content
0.3814

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2641.40 kcal/mol
Thermodynamic ensemble
Free energy: -2811.80 kcal/mol
Frequency: 0.0000
Diversity: 2220.35
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((.....((...)).....((((.((((..((.(((((.(((((.......))))).)).))).))..))))))))...))))))))(((((..(((((((((((.((((((((((((........))))...((((..(((..........))).)))).......(((((((..(((.(((((((((...(((((((((((.(.(.(((((((((((((((.....((((......))))(((((((..((.(((((((((((((.((((((((.((((((((((.((((((((((((((........)))))...((((((((((((((.((((..(((.((..........)).))))))).((((((((((((((((.(((((((((((.(((((.....)))))))))........(((((((.......))))))).(((((.((....((((((((((((((((((((......((....((.((((((((....((((((((((....((((((..((..((........))..))..))))))......(((((...(((..((((((((.........)))).......))))..)))...))))).((((((........))))))...))))).)))))...)).)))))).)).......(((((((..((((.....)))))))))))((((((((((.(((((((....((((((.(((((((((((..(((((...(((((((.((((((((((((.(((..(((.((((..(((((((((.....)))))))))..))))..(((((((.((.(((((......)))))..)))))))))..((((((.((((((.((.((..((((..........((((((((.(((......))).))))))))........))))..)).)).)))))).))))))........))))))..))...))))).)))))(((((((((((............((((((..((((((.((((((((((((((((((.(((((((...(((((((((...((((.......))))..))).))).)))((((((((((((.((..........)).))))))))))))........(((((.((((((.......(((((..((((((((((((((..(((((((((((((((((((((.............(((((((....))))))).....(((((.....(.(((.....)))).....)))))....))))))))))))...)))).......)))....))..)))))).))))))))...)))))))))))..)))))......(((((((.(((((.(((((((((.........)).)))))..(((((....))))).......((((((((((((((.((((((((((((((((..............))))))).........................(((((....))))).......((((((((((...((((.((((((...................)))))).))))..))))))))))..............)))))))))...)))))..(.((((((.((((..((((((((((((((.......))))).....)))))))))....)))).)))))).)........)))))))))..))))))).))))))).(((.(((.((((.((((..(((...((((....))))....)))..))))...))))..)))))).....)))))))...))))).....(((((((...(((......))))))))))....)))))))))).(((....((((((...))))))..)))))).))))))..))))))...((((((.((......))..))))))....(((............)))))))))))))).............)))))))..)))))...))))).)))))).))))))((.((.(((.(((.(((((..((.((.(((((...((......))...))))).))))))))).))).)))))))...)))))))..)))))..)))))....(((((((...((((.....)))).))))))).((((((.(((((...))))).)).)))).......((.((((((((((((((((((((.(((((..((((................(((((........))))).....(((.((...)).))).......(((........)))..............))))..)))))..))))))..))))))))).))))).)))).....))))))))).......)))))....)))))).....)).)))))....((((((((((..(((.....)))...(((((.(........).))))).))))))))))))))))).)))))).)))).)))))))).))))))))))))..((.(((((...((((...(((((((.((((((.((........)).))))))..)))))))..))))...)))))...))....)))))))))))))....((((((....))))))(((((.(((.....)))))))).....))))))((((....)))).((((...(((...((((((.......))))))....)))...))))((((...))))..(((((((((((((....)))))))))))))..))))))))))).)))).))))))))..))))))).......((((.....))))......(((((...((((..(((.(((((((((((((((.((.......((((((((.((((....((((...(((.(((((((((.(((((((....)))))))....((((((((((.(((((.((((((.............(((..((((.((((((((.........(((((((((((((.............((((((((((.......(((...((((.((((....(((((((((.......))))).))))...(((((((((..((....))....))))))))).(..((((((..(......).))))))..)...(((.(((((((...............))))))))))...(((((((........))))))))))).))))..)))(((((.....)))))(((((....)))))....((((((........))))))(((((((((((...(((.((((.......(((...((.....)).)))..(((.((((((..((.((((((((..((((((................((((..((((((......))))))....((((((((((.............))))))))))...((((.((((((....)))))).))))....(((((..(((((((.((((((((...........................((((((((...))))))))((((((((.(((((((((((((.((....)))).))))))..)))))))))...)))).(((((.........((((((.......(((....)))......))))))..........)))))((((.((.((.((((.......)))).)).)).)))).((((..........))))...)))).)))).))))..)))..)))))))))))))))....(((....)))......(((((((((.((((...((((..........))))..)))).)))))))))..((((((((...)))))))).)))))))).))..)))))).))).))))))).)))))).)))))............)))))))))).............)))).))).)))))).)))))))).))))..)))(((.(((((...(((.((((.((((((..((((.....))))..)))))).)))).(((.((........))))).)))..)))))))).....(((((((((((..(((.(((.......((.........)).......)))..)))..)))))).)))))))))))..)))))...)))))))))).......................((((((((((((((((.....))))))((((..(((((.....))))).))))((((((((((((..............))))))).)))))............)))))).))))..........)))))).))))))...)))))))).))))))))......((((((((((((((..(((((....(((.((((..(((.((....))))).)))).))).........((((..(((((((((.(((((.((((((.((((((((..........((((.(((......((((........)))).....(((((((((.....((..(((.(((..(((((.......)))))...)))...)))..))(((((((((..(((((((.(((.....))).)))))))...(((......))))))))))))((((.(((((.((((....((..((.......))..))....))))))))).)))).....)))))))))........))).))))(((((((((((((((((((.((((((((((......))))).....)).))).))))...(((((((((..(((....(((((((.(((((.....((((.((((((((((((((.((((((((............(((.((((..........)))).)))...((((.......))))(((((.....((((........))))...))))).......(((((((.........))))))).......(((((((((..(((((((.((.......(((((..(((.......)))..))))).)))))))))........))))))))).)))))))).)))).((((..((.(((((...((((......)))))))))))..))))..)))))))))).))))....(((.(((...(((((((((((.......))))...(((((....)))))..........))))).))...))).)))(((((((((......(((((((............(((((((.(((((((((((((((((((((((((.((((((..(((((((.((((((((((((((((((((((((((((((((((((((((.((((((((((((((.((((((((.((((((((((((.((((((((..(((((((((.((((((((((.((((((((((.(((((((((((((((.(((((((((((((((((((((((((((((((((((((((.(((((((((((((((((((((((.((((((((((((((.(((((...(((.....)))(((........))).........(((((....)))))(((((.((((((((.(((.((((((.....(((..(((((((((....(((((.(((((..(((((((...(((((((((((......)))))....)))))).)))))))..)))))...)).)))..(((.....)))......)))).)))))..))))))))).))).)).))))).)))))).....((((((((..(((((..(.((...)).)..))))).....))))....)))).......((((((...(((((((((((((((((((.((((.(....).)))).))))))..............)))))).))))))))))))).((((((..(((((((((((((.(((((((.((((.((..((((..((((.(((.........))).)))))))).....)).)))).))))))).)))))))))))))..))))))...((((((.(((.................))).)))))).))))).)))))))))))))).))))))))))))))))))))))).))))))))))))))))))))))))))))))))))))))).))))))))))))))).)))))))))).)))))))))).)))))))))..)))))))).)))))))))))).)))))))).)))))))))))))).)))))))))))))))))))))))))))))))))))))))).)))))))..)))))).))))))))))))))))))))))))).)))))))....((((((.(((((((.((........)).))))))).))))))....((.((((...((((.(((..((((((....))))))....((((((....))))))((((.....)))).)))))))..))))))......))))))).....)))))))))((((............)))).((((((....))))))..))))).))))))).....))).....))).))))))((((((....)))))).(((((....(((((((((((......)))))))))))..)))))......................(((..(((..((((((..((.(((((....))))).))..)))))).)))..)))((((..(((.......)))..))))....((((((((...))))))))))))))))).)))))))))).)))))))))).))))).)))....)))))).)))).......((((.(((((..((((((.((((.((((((((((((.(((((..((.....))......................(((((((((....))))))))))))))(((.........)))........(((.((((((((((.........((((((......))))))..............((((.(((((...((((.........((((((((.((.....((.((((((....)))))))).......)).)))).))))......))))....((((.((((............)))).))))...((((((....))))))..(((((.(((((....))))).)))))..))))).))))(((((.((((((.((.(((............))).)))))))).)))))..((((((....).)))))...((((..........(((((.........)))))))))..........)))))))))).)))...)))))))))))).))))....(((((((...((((.....))))...))))))).....))))))..))))))))).)))))))))))))...))))))))))))))))))))))).)))((((((.((((....))))..))))))......((..((((((((........))))))))..))..))))...))))).........(((((((((((((((......))))))))))))))).......)))))).........((((((((((...((((((((..((((....((((((((...(((((.((((...(((((((..((.(((((......))))).........((((.......))))((((((((((.((..((((.......)))).))))))((((.(((.((..(((....))).)).)))...))))((((((((.((((.(((((((..(((((.((((((....))).))).)))))..))))))).)))).)))))))).........))))))((((((((..((((.........))))...))..))))))........))..))))))).)))))))))..))))))))...))))..)))))))).)))))))))).......))).)))))).).).))))).........((((((.............))))))))))))..))))))))).)))..)))))))((((((.((((((((....)))))(((..((((..........))))..)))....)))))))))(((.((........)).)))...))))).))).))))))).))))...............(((((((...((((((((...........(((((((((..((((((.((.(((...((((.(((.........)))...))))..(((((..(.((((((((((....(((((((((((...((((((((((((((((...........)))...((((((((....((((((((((...(((((...........)))))....)))).))))))...))))))))))))))))((((.(((...((.((.((((((((......)))))))).)).))))).))))...............))))).))))))))(((.(((....((((((........((((((((((((((........)))).....((((.(((.....(((((((....)))))))...))))))))))))))))).....))))))....)))))).))).))))))))((((((((..(((((........).))))...))))))))....((((((....)))))))).)..)))))((((((.((((..(((....))).)))).........(((.((((((.((((((...))).)))))))))))))))))).)))..))))))))..)))))))))...((((((.(((....(((((((((((((((....(((((...(((.........))))))))......)))).))))..)))))).)....))).)))))).....(((((......)))))..((((((((((...))))))))))..((((((...(((((.(((....))).))))).))))))...................)))))))).................))))))).)))))...........
Thermodynamic Ensemble Prediction
...((((((((.{{{.(({{.|,.....,{{{,{{{(,.{{,{(({,.((({(.,.....))))).}}.}}}.}}..)))),,))}..))))))))||,,(({((,.((((((({((,((((({(((........)))){{.(((({,((,.......,,.}},.}})).......(((((((..(((.((((((((((({(({{,((((((.{.(.(((((((((((((((.....,{(({,,{{,||||(((((((.,,({({{,,|||{||||}|{{{{{{{,{{{{{{{{{{.|||{((((,{({{{.....,{,|}}}},},|(((((((((((((.((((..(((.((..{,....,,)).))))))).{(((((((((((((((.(((((((((((.(((((.....)))))))))........{((((((.......))))))|.(((((.{{....(((((((({(((((((((({......(({{..((.(((((((({...(((((((((({{{{({{{({,,({,{((,,,,,.,,|}..}|,.}}}}}}|||..,,{{,...,}||,.|(({{|,,.},},,.,||,...,,....,,,.....}}}..))))}||||,|}}......))))),...))))).)))))...|},)))))).)).......(((((((..(((({...}))))}))))))((((((((((.(((((((....((((((.(((((((((((..(((((...(((((((.((((((((((((.(((..(((.((((..(((((((((.....)))))))))..))}}..(((((((.((.(((((......)))))..)))))))))..((((((.((((((.((.((..((((.....,,...((((((((.(((......))).))))))))..,,....))))..)).)).)))))).))))))......,.))))))..)),.})))}}.)))))(((((((((((....,,,,....,(((((..((((((.(((((((((((((....,.{((({.{,..{{{{{({{{..,((({...,,,.}}}}..),,.))).|||((((((((((((.((..,,....}.)).)))))))))))),,......(((((.((((((,......{((((..(((((((((((((({.(({,,((((((((((((((((.............(((((((....))))))).....(((((.....(.(((.....)))).....)))))....))))))))))))...)))),,.....})),.,.)).})))))),})))))))...)))))))))))..))))),,{((((((((((.((({{{((((((({{.........)).})))),,{((((....))))}.......((((((((((((((.((((((((((((((((....,,...,,...))))))).........................(((((....))))).......((((((((((...((((.(((((((((..{{....}}..))),)))))).))))..))))))))))....,.........)))))))))...)))))..(.((((((.((((..((((((((((((((,....,.))))).....)))))))))....)))).)))))).)........)))))))))..}}))))).)))}}})))))},|{.((((.((((..(((...((({....})))....)))..))}}...))))..}}|((((,,((((...)))))))))).....|||{{|{...{((......)))))))))}}}},)))))))))),{{{....((((({...})))))..}}}))).))))))..)))))|,,,(({{{{,||,,..,,|...))))))...,|{|...,.,......,,.))))))))))).............)))))))..)))))...))))),}))))).))))))({.,(,(,,.(((.{((({..((.((.(((({...((......))...))))).))))})))}.))).)))}}))...)))))))..)))))..)))))...,(({{{{{.,,{{{{.....))}}.})})))),(({{{{.{((((...))))).)},}))),,...,,((.((((((((((((((((((((.(((((..((((,{,,{,,.......,.(((((........)))))..,,,{{{{((...{{(({.....}}}}|...,},.,.}}},,,,..........))))..)))))..))))))..))))))))).))))).)),,..,),)))))))))},.,,..,}}},....))))))..,,.)}.)))))....((((((((((..(((.....}))...{((((.,........,.)))),.))))))))))))))))).)))))).)))))))}))))),}))))))))))}{{((.,,|||,..((((.,.(((((((.((((((.{(,,,....})),))))))..))))))).,))))..,||}},.|{|{{{{{||||||||}||||..{{,{,(((.,.,||}|||(((((.(((.....)))))))).,}},.))},},||}...)),.)}||,{...(((.{,((((((.......))))))|...}}}...))}}|(((...)))}..(((((((((((((....)))))))))))))..,}}}},,,}))}))))}))))))),.,}}}}}}........(((({...,))))......{{{|{.,{((.({.(((.(((((((((((((((.((,......{((((((({({,,..{{((((...(((,(((((((((,,,{((({.,.,|||,}}}.....,,((((((((((((((.,((,....)}..))))}}}}))))))}.((((((((.........{((((({((((((.............((((((((((,{.,,.,(({{{{({({.{{.{,...{(({{{{{{{{,.,,||}}}},)))),..,|||||||||,{{,{,{{({{..,.,,})))}.,..((((((..{......}.)))))).,|,,,(((.(((((((...............)))))))))}...(((((((........))))))),,...}}}|{{{||(((((.....))))),||||,,,,|||||....{{||||,}},....}}|||||||{{{{{,{{|..||{.,(((,.....||||..,{,.,,,{{{,,,,.,|{{.{(((((..((.((((((({.,{,,{{,...............,{{,..,((((((......))))))|...((((((((((.{{........},))))))))))...((((.((((((....)))))).)))).....{(((((((((((,{((((.{{{{......................,,},((((((((...))))))))((((((((.(((((((((((((.((....))))}}))))),.}))))))))...))))..,,((.........||,((({({....|||}}}})))}}}.})))))))}},.......}},}(((((....}}}||(({{.,,.,||||.||.,,.})|))|||,..|,.},},.}}}}.,|||}|,||||{||||{{{||(.,,,.}).)))))),...}}||}|,|,,,},..||,(((((((((.((((.,.{(((,,....,}},}}},.,)))).)))))))))..{||{{{{{...)))))))}.}))))))}.))..)))))).)))}))))))).})))})|)))}}|,,,,,......)))))))))).............))))}}|}.)))))}.)))))))).{{,{((((((((.,,,,,...,|{{|{{{({((({{{((((,{{.(((,,,,,.|||{((((((((((({(,,,{(({{({,....},,,},,,,.....,..(((((((((((..(((.{{{...,,..((.........,,,.....,)},..)))..))))))},)))).,,|,..|,,.,},|}}|||..{{{{....,,,.......,,.,...,}})))}..,,(((((((.....))))))))).}}.}}))))))))}))}}}}}}||((((((((((..,({....}),,.))))))).)))},,,,,,}},.,))))))}}}}}}}},|,,|||..}))))),})))))...))}}}},,.}}|||||||,....{{{{{{|||||{{|..{{{{{.,,,{{{.{({{..{{,|||,,,,)})}}.}})}.,},......,,.{({{..((((({(((.(((((.((((((.(((({{{{..........{({{.{{{......{(((........)))).....{((((((({....,((..(((.(((.{(({{{.......}))})}).)))...)))..))|((((((((..(((((((.(((.....))).)))))))...(((......)))))))))))}{(((.{((((.((({..,.((..{{.......))..)).,..))))))))).)))}.....)))))))))........})}.))))(((((((((((((({{{{{.,{{{{((((({....,)))}}...,,)}.))}.}))),,,{((({((({,.,{{.,..(((((({.{((({.....((((.((((((((((((((.((((((((.........,{{(((,,{{,....{{....||||{|||,..((((.......))))(((((.....((((........))))...)))))........,{{|||},}||,...}}},}))))))}..(((((((((..(((((((.({.......(((((..(((.......)))..))))).)))))))))........))))))))).)))))))).))))}|(((..{{.(((((..,((((......))))))))),}..))),..,))))))))).))))....{{{.{{(...{{{{{{{{{{{.,.....}))},..(((((...,||}}}..,......,}}}}|.}}...|||.}||(((((((((...,{.(((((({............(((((((.(((((((((((((((((((((((((.((((((..(((((((.((((((((((((((((((((((((((((((((((((((((.((((((((((((((.((((((((.((((((((((((.((((((((..(((((((((.((((((((((.((((((((((.(((((((((((((((.(((((((((((((((((((((((((((((((((((((((.(((((((((((((((((((((((.((((((((((((((.(((((...(((.....|}}{,{........|||{,,...,,}||((({{{{|,,},(((({,{(((((((.(((,,{{,,,..}}||,,,.{({{{{(((,..,,{{{{.{{,{{||(((((((...(((((((((((..,...})))},..})))))).))))))},,}}}}}..{||||||..,||}}.||}|,..,,.,}),)}}}}}},..}))))))),,},.))}})))).})))))..}}}|||||{{,.,(((((..{.,{,..}}.},,|||,,...,})))}....}))}...,,,,{|{{{{,,,{((((({((((((((((((.((((.(....}.)))).))))))}.............}))))).}))))))))))}}.((((((..(((((((((((((.(((((((.((((.((..((((..((((.(((.........))).)))))))).....)).)))).))))))).)))))))))))))..))))))...{(((((.(((.................))).)))))).))))).)))))))))))))).))))))))))))))))))))))).))))))))))))))))))))))))))))))))))))))).))))))))))))))).)))))))))).)))))))))).)))))))))..)))))))).)))))))))))).)))))))).)))))))))))))).)))))))))))))))))))))))))))))))))))))))).)))))))..)))))).))))))))))))))))))))))))).))))))}....{(((((.(((((((.((........)).))))))).)))))}....{(.((((...((((.(({..((((((....)))))).,,,(((((,....})))))||{{.....)))).)))))))..)))))}......)))))))..,..))))))))},(((...........,||,,.{(((((....)))))}..})))}.})))))).....)))}....}}}|||}}}|({(({(.,.,})}))).(((((....(((((((((((......)))))))))))..))))),...............,,,,..,{{..(((..((((((..{{.(((((....))))).}}.,)))))}.})}..))|((((..(((.......)))..)))),...((((((((...))))))))})))))))).))))))||||||))))))))).))))).})}....}})))).)))),,.....((((.(((((..((((({.((((.((((((((((({.(((((..|,.....,,...,{,,...,})}........(((((((((....))))))))))))))(((.,.....,.))}........(((.((((((((({.......,,||{{{{....,,)))))},,,,,........,{{{|.{{(((...((((.....,{,.((((((((.((.,...((.((((((....))))))}).......)).)))).)))),}}...)))),...{(((.((((...,........)))).))))|,,((((((....))))))..(((((.(((((....))))).)))))..))))).))))|((((.{(((({.((.(((..........}.))).))}))))).))))}..|||||,,,}}},}}}}}...{{{,.........,(((((.........))))))},,.......,},)))))))))).))}...)))))))))))).)))}....(((((({.|,||{{.....})),,},))))))).....))))))..))))))))).)))))},)))))...,))))))},))))))))))))))).)))||,|||}||||,}}}))}),{||,,,,..,},.((..(((((((({......,))))))))..))..},,,...,}}}}.........(((((((((((((((......))))))))))))))).......)))))).........((((((((((...((((((((..((((....((((((((...((({{{((((.,.{(((((({{({,{((((......))))}.,,...,|.{(((.......))))|||{{,((((.((..((({,,....,)))).))))))((((.(((.((..(((....))).}}.))).,.))))((((((((.((((.(((((((..(((((.((((((....))).))).)))))..))))))).)))).)))))))){,.......}))))},{||||||||||||,,,,,,}},||}|...}}..,}}}}}.....,,}))..)))))))})))))))))..))))))))...))))..)))))))).)))))))))).......))).)))))).).}.)))))}........((((((..{.......,..)))))),)))))).))))))))).)))..))))))){{{{|||||((((((....)))))|{(..((((.,........))))..}}}....})}))}}}}{{{.,{........,,.)))...)))))}))}.})))))}})))).,,,,{{{{{{{...(((((((...((((((((...........{((((((((..((((((.({.(((...,({{.,,,...,,..,,||,..,)))|..(({(((({.((({((((((,,,,{{{((((((((...(((((,{{{{{{,{{{.,,{,{..,,,}||,.,{{{(({{,..,.{{{{{|||,|},,|||||......,{{,{||}}|.{{{,,||.,,})))..,)),)}}})))))))},((((.(((...{{.((.((((((((......)))))))).)).}}))).))))...............))))).)))))))){{{.{((,,{,((((((,...,,,.((((((((({((((........))))....,(((,{(((.....(((((((....)))))))...)))))))))))))))))....,|||||}....}))))),)},,))))||||,{{({{{,..{{{||,,.....,),)))}.}})))))}},....|{{{{|,,,.,})))}))).})))))){{|{{,.,{{{..{{{,...}}}.}}}},.,,,,...(((.((((((.(({({,...,}).))})))))))))})}})}.)))..)}))))))..))))))))}...((((((.(((.{,,{((((((((((((((..,.(((((....,,.,{{.....))))))))......)))).))))..)))))).}.,},))).)))))}.....(((((......))))}..((((((((({...})))))))))..((((((...(((((.(({....))).))))).))))))...................)))))))).................)))))))..))))},..,,,,...

Transcripts

ID Sequence Length GC content
GACGGAGAGGGCCACCGCCCAGCAAUAGACGGUGCCUCAGCCUGCCGAG… 9044 nt 0.3814
Summary

Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway. [provided by RefSeq, Jun 2012]

Forensic Context

A study in rats using single-cell transcriptomic analysis identified the GNAI3 as an orthologous gene associated with inflammatory processes in radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In pediatric septic shock patients, whole blood RNA-Seq identified two subclasses, where the GNAI3 was among a set of gene expression markers noted in the discussion as part of a previously validated signature shared with a prior pediatric sepsis endotype [Yang et al. DOI:10.1186/s13054-023-04689-y].