Basic Information

Symbol
GNAS
RNA class
mRNA
Alias
GNAS Complex Locus NESP55 GNAS1 NESP GPSA SCG6 SgVI Guanine Nucleotide Binding Protein (G Protein), Alpha Stimulating Activity Polypeptide 1 Adenylate Cyclase-Stimulating G Alpha Protein Alternative Gene Product Encoded By XL-Exon Extra Large Alphas Protein G Protein Subunit Alpha S Secretogranin VI Protein ALEX GNASXL GSP Guanine Nucleotide-Binding Protein G(S) Subunit Alpha Isoforms Short Guanine Nucleotide-Binding Protein G(S) Subunit Alpha Isoforms XLas Guanine Nucleotide Regulatory Protein Neuroendocrine Secretory Protein 55 Protein SCG6 (Secretogranin VI) Protein GNAS EC 3.6.5.- C20orf45 XLalphas AIMAH1 PITA3 AHO GSA POH
Location (GRCh38)
20:58839718-58911192
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
-
External database
HGNC NCBI Ensembl OMIM UniProt UniProt UniProt UniProt GTEx

MANE select

Transcript ID
NM_000516.7
Sequence length
1854.0 nt
GC content
0.5620

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-635.60 kcal/mol
Thermodynamic ensemble
Free energy: -669.07 kcal/mol
Frequency: 0.0000
Diversity: 507.54
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((.(((((..((((...((((((((..((((.((.((.(((.....))))))).))))..))).(((((((((.(........).)))))))))(((.....)))........((((((((((.(((((((((...((((.(.(((...))).).))))...))))))...(((((((((.((((.((..(((((.(((......))).))))).))..)))))))).((((((....).)))))((.((((((((.((((........)))).))(((((((.((.(((....((....((.((((((((((...........))))))..)))).))....))....))))).))).).))).................((((((.((((..((....((.(((((...)))))..)).))..)))).)))))))))))).)).......)))))((((.((((((....((((((....)).))))....))))))))))...)))..)))))).)))).))))).)))))))))..))))).((((.(((((((....(((..((....((((((....................(((((.((((...(((((((((((((((.(......)))))).....(((.(.((((((((.(((((.((((....((((.(((.....))).))))(((((..(((.((...((((((((.(((((((((((........((((........))))..)))))))..))))(.(((((((((((((......((((....)))).((((..((...((((....))))...))))))....((((.....)))).))))))).....)))))))......((((((((.((......)).).)))))))(.((((((((..(((....))))))))))).)..))))))))))))))))))))))..)).))))))))))).).)))...))))).)))))...))))))))).....(((..((((((((((....))))))).)))..))).........((((..(((....)))..)))).........))))))...))(((((((....))).))))((((((......)))))))))...))))))).))))((((.((((........)))).))))(((((((.((((.(((((((.((..(....)..))...)))))))..)))).......(((((((.((((...((((.((((.(((..((.(((((((((.(...((......))..)))))))............))).))..))))))).))))....(((.(((((..((((((((.((..(....)..)).))))))))..))).)).)))...(((((((((((.(((.(((((((..(((.....))))))).)))...))).)))....))).)))))....((((((((..(((((((((.................((((((((((((((((...............))))))).(((((.(((((((((((......)))..))))))))...((((....((.(((.....))).))..))))((((......))))......))))).((((((.......))))))...)))))))))(((((................)))))......))))))).))(((...)))...............)).))))))...........................................)))).))).))))............................))))))).....
Thermodynamic Ensemble Prediction
.(({(((((.(((({.,((((..,((((((((.,({{,,{|.||||||.....|}|||||{|||,.,||}.||||||||(,(,.,,..,.}.)}))))||||{|,,},}}}.....,,,.((((((((((.((((((((({,.(((({..((({{.{||.|.|,||{.{|||||,.....(((((((.((((.(,,.(((((.(((......))).))))).),,.)))))))).||||,}}}}}).))),).|.}}},,,))}}}.|}}}}.,..,))},))((({(((.({{(((..{.((.{..((.((((((((((...........))))))..)))).))..,.)).,..))))}.))),).))),................((((((.((((..((....({.(((({...)))))..)).))..)))).)))))))}}|||{||{...,}})))}.((((.((((((....((((((....)),})))....))))))))))...)))..)))))).)))).)))}}.)))))))))..))))).((((.(((((((.,..(((..{{....{{((((.............,,}}...(((((.((((...(((((((((((((((.(......}))))).....(((.(.(((((((,,(((((.((((...,((((.(((,,,..|||,}}}}|{|{|,,|,{.{{.|,{,||||||.{{(((((((((........((((........))))..)))))))..}}}}{{(({{{{(((((((..,..,{|{(,...}|||.((((,.,,...{|||.,..||))...},)))),,..((((,...})))).))))))){{{{{.{{{,||..,,,.((((((((.((......)).).))))))),.,((((((,,,(((....))))))))))},}}})),))))),}}))))),,))))..)).))))))))))).).)))...)))))}}}))).,.)))))))))...,.{((,.({((((((((....)))))))}})),.|}|,|.......((((..(((....)))..))))........}}})}}},,,}|{(((((,....})),,)))|(((((......))))))))).}.))))))).))))((({.(({(.,,.....}|||.|}}|||||,.({(,(({(((((((,{{.,,....}..})..,)))))}}..,)))))}..{{(((((((....,..,(({(.{(((,({(,{({.,(,((((((.,...,{.....,,}..,)))))),.,},,...},,}}}.)}.}))}||||.||}}{{,|(((.(((((.,((((((((.((..(....)..)).)))))))).,))).)).)))}}..|},}|||{{{.{{{.{,||||||.{{(...,.}}}|},,.}}}.,,))}|}||{,,..{(({....})))((((({,,.,({(((((((.................((((((((({{{{(({.,|,....,,.....}}}}))).(((((.(((((((((((......)))..))))))))...((((....{(.{{{.....))).))..))))((({......})))......))))).{{((((.......))))))...)))))))))(((((................)))))......)))))))}),,{{...,}}...............}),)))})}..........................,...,..........}}})})})))}})),............................)))))))},...

Transcripts

ID Sequence Length GC content
NM_016592.5 NCBI
AGUCUCCUCUGUCCUCUCCCAGGCAAGAGGACCGGCGGAGGCACCUCUC… 2551 nt 0.5539
NM_080425.4 NCBI
AGACUCCAAAUCAGUCAGGGAGAGGAGUGGAAGGAGCCAAAACGUCCCU… 4027 nt 0.5890
NM_080426.4 NCBI
AGCAGCUCCCGCAGCUCCUGCUCUGGUCCGCCUCGGCCCGGCGGCGGCC… 1809 nt 0.5594
Showing 11 to 13 of 13 entries
Summary

This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors. [provided by RefSeq, Aug 2012] CIViC Summary for GNAS Gene

Forensic Context

No relevant information is available at the moment.