Basic Information

Symbol
GNB1L
RNA class
mRNA
Alias
G Protein Subunit Beta 1 Like WDR14 GY2 Guanine Nucleotide Binding Protein (G Protein), Beta Polypeptide 1-Like Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 WD40 Repeat-Containing Protein Deleted In VCFS G Protein Subunit Beta-Like Protein 1 WD Repeat-Containing Protein 14 DGCRK3 WDVCF Guanine Nucleotide Binding Protein Beta-Subunit-Like Polypeptide G-Protein Beta Subunit-Like Protein KIAA1645 FKSG1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Forensic psychiatry evaluation

MANE select

Transcript ID
NM_053004.3
Sequence length
6642.0 nt
GC content
0.6110

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2943.20 kcal/mol
Thermodynamic ensemble
Free energy: -3052.77 kcal/mol
Frequency: 0.0000
Diversity: 2108.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((....)))).)))..((((..((.....))..))))(((((((((((((((((.(((.((((.......))))((((((.(((((...((((((((((....(((((..((((((((((..((((.....((.((((((((((...(((....((((((.........((((((((((((((....(((((((((.....)))))......))))((((........))))(((((((.(((....)))((((((((....))))((((((....))))))))))...((((...(((((((((.(((.......((((((((((..(((((((.((((((........((((.(((((..(((((((((.........(((((((..(((((((..((((((....))))))((((((((.......))))..)))).(((((((((((((((((..((((.(((((((.((((....(((((......)))))(((((((((((((((((((......))).)).)))))))...)))))))....((((((((...(((((..(.(((..((((..........(((((((.....)))).)))))))..))).).))))).(((((.(((((.(((.((.((...)).))..))).))))).))))).)))))))))))).)).))))).))))....(((((((((..((..(((...((.((((.(((((((((((.(.((((((.((((..((((((....))))))..)))))).)))).))))).)).)))))))))))....)))..))..)))))))))..(((((.((.((((((((.....((((.(.((((((...)))))).).))))...)))))).)).)).))))).........((.((......)))).)).))))))).......(((((((((....))).)))))).))))))))((((((...(((....))).))))))..))))).)).))))))))))))))))..))))).))))....)))))).)))...))))((((..((..(((...))).))..))))))))))))))..((((....)))).)))...)))))))))))))..))))))).(((..(..(((((.....)))))..)..)))))))))))))).)))((((.....))))..((((.(((((.....(((((((((((((((((((.(((...((((((((...)).)))))).......)))))))))).)))(((((((..((....(((((((............(((((((.(((((((.......))))))...).)))))))(((((((..((((((.((.((((((((...(((((((.(((..((.((((..............((((((((..((((((...)))))).))))))))..)))).))..)))((((((((....((.((((((..((((...............)))).)))))).)).(((((.(((......(((........)))......))).)))))((((((((((...))).))))))).....((((.(((((...(.((.((.((..(((...((.((((((.....)))).)).)))))..))...)).))).))))).)))).)))))))).((((.......))))((((......))))..(((((......((((((((..(((((.(((.((((((((.(((((....(((((.((((((....((((((..((((((.....))).)))((((((((((..(((((((.((.((((...)))).))))).((.(((((..(((((...((((((....(((((..(((((((((...((((((((.....(((((....))))).....((((....))))......((((((.(((((((((....((((((..(((..(((.(((((((..((((((((..........((((((.(((((.(((((((((((......(((......((((.(((...(((.......))).)))))))......)))(((((((((.((((((((.((((.....))))..(((((((........((((((.(((..((((((((.((((((((.((....((((((((((((((((....)))))...)))))))...))))..)).....(((((((((........(((((((((((((......))))))....)))))))......))))))..)))....)))))(((..((((((.(.(((....))).))).))))..)))..))).))))).))).))).))))))..........)))))))...(((((((..(.((..(((((...(((((((((.((.(.(((((.((((((.(((.(((((..(((.(((.((....)).))))))..))))).))).).((((((((((.....)))))))).)).(((((((((((((((((((.....)))))....((((((((((((..(((..((((.((((((.....))))))((......)).((((((((((....(((((((((((.((((.((((.......(((((((.((..((((.....))))((((((..((((((((.((((((((((((....(((.....))).)))))..))))))).))(.(((((((.((...(((.((((((.((......)))))))).)))..)).))))))))(((((........)))))((((((((.(((((......)))))....((((.((((.((......)).)))).))))....(((((((((((..((.(..(((((.((....)))))))..).))..))))(((((((((((((((((((.((((.(((((((((((..((....))....))))))))))).))))(((((....))))).(((..((((...(((((((.((((..(((.(((.(((((((((.((((.((.(((((.....)))((((((((((((.(((((....((((((.((((((((((..((((((((...)))))))))))..((((..(((((((.(((.((.(((((....(((..(((((.....))))).))).......(((((....)))))......((((..((((((........)))))).....)))).)))))))))).)))))))..))))..(((((....)))))...)))))))((((....))))...........)))))).....(((((...)))))))))).))))))).))))).((((((.....))))))......((..((((.(((.(((...))))))))))..))..(((((..(((((((((......)))))(((..((((...)))))))(((((((......)))))))...((((.(((..(((((....)))))..))).))))))))..))))).((((.(.(.(((....))).).).))))(((((.(((.((((((((.((((...))))...))).)))))..))).))))))).))))))))))).))))))).)))))))..)))))))...))))..)))((((....((((......)))))))))))))).)))))))))))))))))))).(((((((.((((((((((.....(((((((((((((.(.((.(((((((...((((.((....)).))))...)))))).(((((((....(((((..(((...))).))))).((((((.((.((((.((....))..))))..)))))))).)))))))).)).).)))))))(((((((....))))))))))..)))))))).........))))).)))))))((((....))))...))).)))))..))))))..))))))........(((........)))..((((((..((((((((((((((((((.((((((((((((((((.(((.((.((.(((..((((.......))))..))))).))))).))))...(((...(((.((((((((..(((((.((((((((((((((((((.(((.(((.((........)).))).))).))))).....((.(.(((....)))).))((((...))))...((((((.((...(((.(((........)))...))).))))))))....)))).))))))))).....(((.(((...((((.((((..(((((......)))))..)))).))))......))).)))...)))))..))))...)))).)))...))).((((((.....)))))).....))))))...)))))).)))))).....(.((((((...)))))).)..)))))))))).))...))))))......))))))))))))))))).))))))))))).))))...)))))).(((.(((.((....)).))).))).)))).)))...)))))).))))))..((...))....(((((((........)))))))((((...(((((.((..(((((((..((((...))))))))))).)))))))....)))))))))))))))))).........(((......))).))))).))))).))))))).))))))))))........(((((....)))))((((((........)))))))).)..))))))))))))))))))))))))..))))).)))))).)))..)).))))))))))))))..))))).)).))).....)))...)))))).......))))))))....).))))))))))))))..))))..(((((((.(((((((((((((.(..((((((((....))))))))))).(((.(((((((((....((((((((.....)))))))).((((..(((((((((((((((...(((((((((((((((((((((...........)))))))))))........)))))))))).))))).))))))).).))...))))(((((((.(((((.(((((((((((.(((((((((((....).))...)))))))).))....((.(((.(((((......))))).)))))((((.((.....)).)))))))))))..))))))).)))).....)))((((((((((.((.....)).))))).)))))..))))))))).))).........(((((((((.(((((((((((.......((((((((((((((((((...((..((.(((..((((..(((..((((....)))))))..))))..))).))..))...))))))))...........)))))))))).......((.(((....))).))((((.....))))))))))))))).)).))))))))))))....)))))).)))))))..))))).))))).)))))).....))))).))))).)).((((..((((......((((((.....))))))))))..))))......))))....)))))))))).......((((((..(((.....(((...((((((...)))))).))).....)))..)))))).............(((....)))))))))...)))..........(((((((..(((....))).))))).)).)))))))).......))))).)))))).....)).))).)))))..))))))))..))))))))))))..)))))))).)).))))))..)))))))...)))))))...))..))))))).((.(((..(((((...)))))))).))))))))))).(((((((((.(((((((((((((.((((((((........))))))))((((((.((....)).....))))))........)))))).)))).))).))))))))).)))))))))..(((((....)))))...))))))..))).)).))))))))))..))))....)))))))((((...((....)).))))..(((.....)))........)))..)))))..))))))))))....)))))...(((((..((((.((((..(((((((..((((((.((((((((...((((((((.....((((((((((.((.................)).))))))))))((((..((((..((...))..))))..))))..((((....))))....))))))))..))).))))).))))))(((.((....)).)))....)))))))......)))))))).))))).(((((((...(((...............(((((((((((..(((.((((........)))).))).))))))...))))))))))))))).....((((((((.(((((..((((..........)))).)))))...))))))))...)))))).))).))))))))..))))))))).........................
Thermodynamic Ensemble Prediction
....(((((((....)))).)))..((((..((.....))..))))(((((((((((((((((.((({{(((.......)))}((((((.(((((,..((((((((((.,..(((((..,{(((((,,,{({((({{,.|{||{||||{{{{|{.,|}|,.(((((({{{((.,{.(.((((((((((((((....(((((((((.....)))))..(((({((((((,.{{{{,{{({{((,,{(,((((.(((((({(,,((,{(({,(((,(((,(((({((((({{(({(((((((.((.(((((((........))).)))))).)))).))).,.))}))))))......{{{(((..(((|,,,((((((((.{,...,}}}}|}}||,..|}||)}||||}|||||}},|{|....,,(((((.......))))),,))),))))}|)),.}}}}))))}))}|}}|,)))))},,}},}})),.}})).))))))).{{{{(((((((((((((..((({.{((((((((({{((((((...))))).}.}},.))).))))))}.|(((((.{..(,{({.......})}||.|.}))))|||,,(((((((((((...(((((.(((({.,(({{,((({(..,,.{|||||||,|,},}|}}}{|||},{{,{{{(|,,|,}|}}.|}|.},||,|,|.{{{(((((((,,((,,{{{.,,||.||||.(((((((((((.(.(((({{.((((..((((((....})))))..)))))).)))).))))).)).)))))|}}}||,,..}}}..)),,))})))))))}}}}}.))))||.)))))...)))))))).))))))}},)))..))))))).)))))).)),,(((((((((.....,{....|.,,......}||{{|{,,|||||,.}|||||(((((((((....)))}}))))).((({,{(,((((((.,.(((....))),))))))}}.))))....,,,,|||,,,))),||{{||,,,..,,.}}))))|{||{{||{{{.{((((((..((..(((...))).))..))))))),))),,..)||,|}}}}|}}}.})),}})))).,,...)))}})))),}}.,.,.....(((((.....)))))..)))).}))))))))))).))),|,},(((((((........)))))))..|{{.,,(((((((({(,({,.(({...|(((((((...}).)))))(((({...((((((({.|(((,{,.(((({((((......)))))))),,,)}}.})))))))))))){(({{{{{{{|||,||||||||||,}}.{{{||,,||||||{{,|||{{||{|||{{|||{|{||||||,||,|}||||{{{,......,,,}.|||,,,,,{{{.,.(({((,.(({((((((,(((,{((({({.{((.(((({,{..,....,|,|||}},|||}}}}}....,,....}}||.)}}))).}}|}}}}|}|||}..}}}}},,|||..,||{{,..{{{,.|{|||||{(((((((((|.,||}|}}||||,,,...|||},,,||{.,|||||,{{{{({,{{{...{(,((((((.....)))).}},}|||},|}|,}||}|}}}|})}}||||}}||{{,}{({,((((.......)))}{{||,.....}}||,.,{{({,{..,{{((((((,{,(((((,{{..{(((((({.(((((,...{((({{((((({,,,.|||,||}.||{{((({,..||}|)))((((((((((,.((((((,,((.((((...)))).)))}}.{{,{,((({{{(((({..((((({.,,{((((,.{((((((({{.,.(((({(((,.,,.(((((....))))).||..((((,,,,||}|,,{,,.(((((({{((((((((....((((((..((({.(((.(((((((..((((((((..........((((((.(((((.(((((((((((......(((......((((.(((...(((.......))),)))))))......)))(((((((((.((((((((.((((.....)))),.(((((((.,...,,.((((((.(((..((((((((.((((((((.{{....(((((((((((({{((,,..}}|||.,.,|||}}}...)))},,)),....|{{{{,(((....,,..(((((({((((((......}))))).,.,)))))))..,...))})))},,,}....)))))(((..((((((.(.(((....))).))).))))..)))..))).))))).))).))).)))))).,...,..,.)))))))...(((((((..(,({.,(((((...(((((((((.((.(.(((((.((((((.(((.(((((..(((.(((.((....)).))))))..))))).))).}.((((((((((.....)))))))),)).(((((((((((((((((((.....)))))...,((((((((((((..(((..((((.((((((.....)))))){({,...|}},((((((((((....(((((((((((.((((.((((.....{,(((((((,((..((({.....}))}((((((..((((((((.((((((((({({,,,.(((.....)))})))})..))))))).))|.(((((((.((...(((.((((((,({.....,)})))))).))),.)).)))))))((((((........)))))|,,{{,(({(((((((....,,,,}}}})))}..,}||{(((.{({{{,.|{{{.(((({{{{{|,(((((((,{,,,.,,}{||,}}||,}}}))))))).}).))..,}},{((((((((((((((((({.((((.(((((((((((..((....))....))))))))))).))))(((((....))))).(((..((((...(((((((.((((..{((.{,(((((((((((.((((.((,(((((.{((({{{{{{{||||{|||||{{{{,.,,,(((((((..{((.(((,.,{((((((...)))))))))))}}||||}}(((((((((((((,((.((({{,,({{..,{|||,,,,,))})).}}),,,..,.|||||,,,.}}))),,,.,}|}}{,{(((,,({,.{{{{{||||||{{,..||||{.||,|||{,.,,,||,|{{{||,|{{(((,,....,||||{{,.,,,|||((,......,,,..}}}}|....,,.{({.,...(((((...))))).},,}})),{((((((((,{((((((.....)))))),.,,,|})}.})}}},}}}|||}..,.))}),)),}}}}}}.}},,|.}}}((((((......)))))),|..}))))..)))))))(((((((......)))))))...||||}|||..|||||},}}||||}..}},|||||{{{{.{.||.,,,,)).}.})}}}}...))).,,).))),{((((.{((.((((((((.((({...})))...))}))))))..))).))))))).))))))))))).))))))).)))))))..)))))))...))))..)))((((,...{(((,....,))))))))}))))).))))))))))))}.||((({{(.|||(({(((((.(((((.......(((((....)))))))))))))),.............|)})),.}}))))))|.(((((((....(((((..(((...))).))))).((((((.{(.((((.((....))..)))).,}})))))).))))))),})))).)))),..(((((((....)))))))..(((((.....(((((....))))))))))(((((.((((..,....,..))))))))).})))))..))))))....,,,..,.......}})))},((((((..{{(((((((((({{{(((.(((((({{{,,{((((.{{{,{{,{({{((..{(((,,,,...}})).,))))),))))}.)))},..|{|...{{{.{{(((((((((.(,((((((((((({(((((.((.(((.(((.(({{...{{{||{|||.(((.,.((({....{{{...}))....)))}))},))}},,}}}))}))))),.....))))).))))}.)))......((((((.((...))))))))..))))))})),)))))),,||{{,,{({(,((((,,(((((,,....|||||..|}||,|}}|{{,,,.,,..((((({....})}}))).,,)))),))),},|,|.((((((.....}))))),,|||},}},,.},)))))),)))))),,,|,|.{{{{||,,,)))))).),,)))))))))).}}...))))))...,..))))})))})))))))).))))))))))).}})}...)))))).|||.,||.(({.,,|,.}))}})).)))).))).,.))))))}})))}}..||,,.,|...,(((((((........)))))))|(((.,,(((((.((..(((((((..((({...}))}))))))).)))))))..,.)))})))))))))))))),.,...,{.(((......))),))))).))))).)))))))))})))))))),.,,,,..(((({....)))))((((((........))))))}}.}..))))))))))))))))))))))))..))))).)))))).)))..)).))))))))))))))..))))).}}.))).,...)))...)))))).......)))})))),...}.)))))}))))))},..}}}}.,(((((((.((((((|{{{({|,{,.((((((({....})))))))||},{{{.((({(((((....((((((((.....)))))))).{{{(|,{{|((((((((((((.{{(((((((((((((((((((((...........))))))))))}.......,))))))))))}))))).))))))).)}}}|,.)}}|(({((((.(((((.{{{((((({((.(((((((({||....}.)),..))))))})})}....{{.(((.(((((......))))).)))}}||||}||},,}})).,,}.})))))}..))))))).))))..,},)))((((((((((.({.....}).))))).)))))..)}))))))).)}).........{((((((({.((((((((({{,.,,|||((|,({{{{{{{{{(((({{..{..{{,|||,,|{|||,|{||,|{||,,..))))}}))}||||..))).|,,{||,,|))))}}|||......,}}}))))),)}})}}}},,)})}|||,,{{,.|.||((((.....))))))))))))))).)).)))))))|||}},...)))))).)))))))})))))),})))),))))))})}},))))}.))))))),.|||,.,(((,....,,||((((,,...)))|||||}}|||}}}.}}..,}))),}..)))))))))).......((((((..(((.,,,,(,,.,.,{(((,...)))))),))).....)))..)))))).....,,..,..,{(({{{{|...,,,},}}})))}.,.......(((((({..(({....}}}.})))),)).)))))))}.......))))}.}))|||,||,{{,,{{{{|{|{,.,|.))))})}||,}}})),,,))))))))))|||||||||||||{(((((((({.,,,,......||,.,,,,....,,.,,{,.{{{{{,..}})))))).)))),.})))))))))|||||.|||||||||||||.,,,|||||}.}.}}}.))))))))||||||.{{....))}....}}))))}))}...}))})))))))))))).))}})))))}}||||||}|.||||,,|||}.||||{{{(({{,{|{{({||..},.)))))}}}.}|||,...}))}.,)))))))}))}})))))}}}},,|||,,,..))}..,{.,,.,,}..))))),.))))))))))..}|)))))...(((((..((((.((((..(((((((......{(((((((..,{({(.((((..{{,(({,,{((((((.((.....{......,....)).))))))||||||(((((,,,,,||},|}}}|.}},,|||{({(((((((((((.......,.))}})))))),,)))))}),})..))))...)})}.))))))))))))))......)))})))).))))).,,{{(({...,||,,.,.,....,{{.{(((((((((((..(((.{(((........))))})),.))))))}...}},})))))}))),.....((((((((.(((((..((((..........)))).)))))...))))))))...)))))).))).))))))))..})))))))).........................

Transcripts

ID Sequence Length GC content
CUCUGGACGCUGCGCGGCGCUCCUAGGAGCAGGCGUUCCCGACUCCGGC… 6642 nt 0.6110
Summary

This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic cocaine exposure and withdrawal in the nucleus accumbens induced a sustained decrease in the expression of the GNB1L alongside other G-protein beta subunits, which are part of the heterotrimeric G-protein signaling pathway [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X]. In human postmortem brain studies, the GNB1L was identified within a schizophrenia symptom-related red gene module, which was significantly correlated with clinical scores and overlapped with the opioid signaling pathway [Miyahara et al. DOI:10.1038/S41398-023-02449-8].