| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGGCGGGCGGGAUCCCUCCGCUCUGGGGAGGCAGCGCUGGCGGCGGG… | 1664 nt | 0.6442 |
Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the GNB2 was upregulated in ileum tissue from methamphetamine-treated animals compared to controls, identifying it as a differentially expressed gene associated with inflammatory bowel disease [Sun et al. DOI:10.21037/Atm-20-7741]. In a separate investigation of severe burn injury in mice, the GNB2 was identified by another research group as a potential key gene involved in the treatment of major burns and the prevention of complications [Wu et al. DOI:10.007/s10753-019-00984-5].