Basic Information

Symbol
GNB2
RNA class
mRNA
Alias
G Protein Subunit Beta 2 Transducin Beta Chain 2 Signal-Transducing Guanine Nucleotide-Binding Regulatory Protein Beta Subunit Guanine Nucleotide Binding Protein (G Protein), Beta Polypeptide 2 Guanine Nucleotide-Binding Protein G(I)/G(S)/G(T) Beta Subunit 2 Guanine Nucleotide-Binding Protein G(I)/G(S)/G(T) Subunit Beta-2 G Protein, Beta-2 Subunit G Protein Subunit Beta-2 Heterotrimeric Guanine Nucleotide-Binding Protein 2C1 Epididymis Secretory Sperm Binding Protein SSS4; NEDHYDF NEDHYDF HG2C1 SSS4
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Mechanical injury analysis

MANE select

Transcript ID
NM_005273.4
Sequence length
1664.0 nt
GC content
0.6442

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-753.10 kcal/mol
Thermodynamic ensemble
Free energy: -783.15 kcal/mol
Frequency: 0.0000
Diversity: 368.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((.(((((((((...(.((((((.(((.((((((((((((.(.(((......(((......)))(((....))).))).).))).))))))))).))).)))))).).)))))))..))...).)))))))).))..(.((((..(((..(((((.(.((((....(((...)))...))))).))))).))).)))).)(((((((....((((((((((((.....))))).............((((((....(((.((..((((..(((.(.((..(((...)))...))).))).)))).(((((((((((.(((((((.......))))((((((((((((..(((...))).......((((.((((.((((((((((((..(((((((((((((((((((....))))).))(((..(((((........)))))))).(((((((.((((((..((....)))))).).).)))))))((((((...))))))....((((((..((((((.(((.....(((((.((...(((((((.....(((((((.(...(((((.((...(((.((((((.(((...((((.(((.((((((((((.(........).)))))..)))))))).)))).)))..))))))..))))))))))).)))))))((((.(((((.(((.((((((..((.(((((.(((....((((((((........))))..))))...))).))))).))..)))))).))).............))))))))).)))))))....)))))))....))))).)))).)))))).(((((.((..((((.((((((((.....((((((((.(((.(((.((.........(((((((((..(((..((((((.(((.(((((..........))))))))))))))..)))....((....)).......))).)))))).......)).))).))))))))).))((((..((((((((..(((.((....)).)))..))).((..(((((((......((((.....))))..((((((...((((((((((........)))))))).)).))))))(((.(((((((((.(((((...(((((.....(((..((((......)))).))))))))))))).))).))))))))).....)))))))..)).((((.....))))...)))))))))))))))))))))..)).)))))....))))))...)))))).))...........)))))))))).)))).))))..(.(((((((.((.((.........)))).))))))).)((((((((.......))))))))...(((((.....)))))..)))))))))))).......))).)))))))))))....)).)))....))))))..........)))))))..)))))))((((..(((((((((((.......))))))))).((((((((((...(((((...(((((((....)))))))...)))))...))))))))))..((((((((((((((((((...(((..(((...)))..)))...))))))).....)))))))))))...))..))))...
Thermodynamic Ensemble Prediction
..,{(((((((({.(((((((((...(,((((((.(((.((((((((((((.({(((....,.(((......))){{{....})).))).),))).))))))))).))).)))))).),)))))))..)}...}.)))))))).},..{,((((..(((..(((((.(.({((,...(((...)))...))))).))))).))).))))||(((((({.,,,((((((((((((.....))))),,,,.......,.(((((({{{{((,.,,..((((..(((.(.((..(({...}}),..))).))).)))).(((((((((((.(((,(({.......||}|((((((,,(({....||,}})....},},,|(((.((((.((((((((((.,..(((((((((((((((((((....))))).))(((..(((((........)))))})).(((((((.{,((({,.{(....}))))).}.},)})))))((((((...))))))....((((((..((((((.(((.,...(((((.((...(((((((.,,..(((((((.{..{(((((.,{...(((.((((((.(((...((((.(({,((((((((({,(({.....}),)))))..)))))))).)))).)))..))))))..)))}})))))),))))))){(({{(((((.(((.((((((..((.(((((.(((....((((((((........))))}.))))...))).))))).))..)))))).))),..........},)))))))}).)))))))....)))))))...,))))).)))).)))))).(((({,((,,((((,{((({((({((.,((((((((.(((.(((.((.........(((((((((..(((..(((((,,(((.(((((..{,...,,.))))))))))))))..)))....((....)).......))),}))))).......)).))).))))))))),})|,,}}}|||,|||{..||{.{{...|))|)},..|||{{({{{(((((......}}|||..........,||((((.{,{{,,{|{||||....,|,|||||||..,}})))))){((.(((((((((.(((((...{((((.,...{((..{(((......)))).))))))))))))).))).))))))))}.....}})})})}|}}|||||},}}.}})),),})))))))}})))))))))))..)).)))))....))))))...)))))).|,...|.......)))))))))).)))).)))|{{({({{,,,(((({.({{{........||{{,|||,.{.((((((((.,....,))))))))}..|))|,}}}}..})))}..))))),,,,})}}}}}..))).)))))))))))..}}))})))}...,,)))).}.......,)))}}))..))))))}{{{|,,||(((((((((.......))))))))){((((((((((...(((((...(((((((....)))))))...)))))...))))))))))}}((((((((((((((((((...(((..(({...,))..)))...))))))),....}))))))))))...))..)}))...

Transcripts

ID Sequence Length GC content
ACUGGCGGGCGGGAUCCCUCCGCUCUGGGGAGGCAGCGCUGGCGGCGGG… 1664 nt 0.6442
Summary

Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the GNB2 was upregulated in ileum tissue from methamphetamine-treated animals compared to controls, identifying it as a differentially expressed gene associated with inflammatory bowel disease [Sun et al. DOI:10.21037/Atm-20-7741]. In a separate investigation of severe burn injury in mice, the GNB2 was identified by another research group as a potential key gene involved in the treatment of major burns and the prevention of complications [Wu et al. DOI:10.007/s10753-019-00984-5].