| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAGAGCCUGGGCAGGUGACGGGCGGGCGCGGGCGUCGCAGCUGAGGG… | 1654 nt | 0.5828 | |
| AGCAGAGCCUGGGCAGGUGACGGGCGGGCGCGGGCGUCGCAGCUGAGGG… | 1657 nt | 0.5830 |
Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
A study in mice and humans demonstrated that the GNB3 is associated with a chromatin immunoprecipitation cluster enriched in long non-coding RNAs that are up-regulated following myocardial infarction, linking it to cardiac pathological remodelling [Ounzain et al. DOI:10.1093/eurheartj/ehu180].