Basic Information

Symbol
GNB3
RNA class
mRNA
Alias
G Protein Subunit Beta 3 Guanine Nucleotide-Binding Protein G(I)/G(S)/G(T) Subunit Beta-3 Transducin Beta Chain 3 Guanine Nucleotide Binding Protein (G Protein), Beta Polypeptide 3 Guanine Nucleotide-Binding Protein G(I)/G(S)/G(T) Beta Subunit 3 Heterotrimeric Guanine Nucleotide-Binding Protein 2D GTP-Binding Regulatory Protein Beta-3 Chain Hypertension Associated Protein G Protein, Beta-3 Subunit CSNB1H HG2D
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002075.4
Sequence length
1657.0 nt
GC content
0.5830

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-661.30 kcal/mol
Thermodynamic ensemble
Free energy: -693.57 kcal/mol
Frequency: 0.0000
Diversity: 377.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.(((((((((..(((.(((.(((((.(((...(((((((((.....((((((((((((((((.(.(((((....))))))..((((((((((...(((....(((((((((((((.((..(((..........)))..)).)).((((((((.((..((.((......))))..)).)))).))))....((((((....)))).))....)))))))))))..(((((((((.((((.((((..((((.((....((((....(((..((...))..))).....))))..)).))))...)))).)))).)))).(((((((.(((.....(((((.(((..((((((((.....((((((((.((((((((((((..((..((((........))))...))..)))))).))((((((....((((.((.(((((.....((((((((..((((..((((.((..((((((.((..(.(((...))).).)).)))))).)).))))))))))).)))))......(((((((((((((((.....)))).(((((((....(((.((((((((.(...((.((((((((.....))))..(((...(((((.((((...)))).))))))))..)))).))...))))))))).)))....)))))))((((((((((((..(.....).)))))..))))))).((((((((..((((..(((((((((((((((......))).)))....)))))))))...))))..)))......))))).......))))).(((((.(((.((..((((.((((((......(((...((.(((.....))).)).)))..)))))).)).))..)))))))))).))))))))))))))))))))))).)))).)))..))))))))).)))).))).))))).....))).))))))).(((((...((((((((((.....(((.((((((.((.((......(((((.((.((.(((((......))))).)))))))))......))))))))))))).....))))).)))))..)))))...)))))...))).)))))).))))...))))))))))..((((((((((...........))))))))))((((((((...((((((((((((((....))))..((((....))))...(((((((((.....)))))................))))))).)).)))))...))))))))..(((((((.(((((((....((((..(.(((..(((((((.((.((..........((((((......))))))))))))))))).)))).))))))))))).))))))).))))))))))))....)))...)))..)))))))).)))..(((.......)))..((((....((((...((((..(((((((((((..........(((((((((((((((..((....))..))))))((((((((.....))))))))....))))))))).....)))))).))))).))))..))))....))))......................(((......))))))))))......(((...))))).))).
Thermodynamic Ensemble Prediction
,{(((,({((((((..((((.(((((((.(,(((,(((...((((((((({....{(((({,,,.(({{((...(((((....)))))...))))).((((((..(((...((((((((((({(,((..(({,,{,....}})))..)).)).((((((((.((..(,{((......))))..)).)))).))))....((((((....)))).))....))))))))))).....)))..))))))..{((({({(((({{{(.((((......)))).}|.((((.,,.(((((((((((((({..{{{.{{{.(({..,,,,,.}||,,.}}}.}}}..}}{{{,|||.,,,))}..))}(((((((..,,.((.(((((((((..((,.((((........)))).,.))..)))))).))).)}{{(((((,{..((((((.,(,,..((((({{(,,((((..((((.((..(((((({((,.{.({,....}),)})).}))))).)).)))))))),)),)))))..),},))))))}))))))|{.....|}||.(((((((....(((.((((((((.,.,,(({(,(,((((.....}))).}}}}}{.(((((.((((...)))).))))),))..}},,.})...,)))))))).)))....))))))){{.{{,,,(((,(.((((.((((..{{,,{{({(|(((..{((((..({(({{..(((((((((((((((.{.((((.((,..((((((..((((((.((((((((((((((((((((((((({.,(({{{{(((.,(((....,,{{.....})}}...,,}.....(((((((((((..(,,,({((((((((((.((((,(((((((..({...,}..))})))))...{(((((......)))))}.....},)))).))))))).)))..}.,))..))))))}}))))}}}.||||||(({........}..))),,,,,.{{{...........,)))|{{....)))}))))))))).)).)))))..)))))))).)},)),})..))))))..}..)))))).}(((((((((........))))))))))))))))))))))))(((((((((((...........))))))))))))))).,..)))))))))})))}}}..)),.))))))))}}}},))}}}...)))))))....)))))))))))))..,...)))).,|||..,|||||||..{|||||.....,||||||,||||||||,,,((((,,(,({{..{((((((.,,.,,..{{{,....((((((......))))))..}}))))))).)))),))))))))))),))))))).})))))))))))....)))...)))..}}}))))).,)),.)))).))))..)))))}|((({.,,,|}}}((((..(((((((((((,.........(((((((((((((((..({....))..)))))){(((((((.....)))))))}....})))))))).....)))))).))))).))))..,,,,.,,.}))}...........,,{{{,,,....,,......}}}...{{|{|..,,,},))))....,,)},.

Transcripts

ID Sequence Length GC content
AGCAGAGCCUGGGCAGGUGACGGGCGGGCGCGGGCGUCGCAGCUGAGGG… 1654 nt 0.5828
AGCAGAGCCUGGGCAGGUGACGGGCGGGCGCGGGCGUCGCAGCUGAGGG… 1657 nt 0.5830
Summary

Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]

Forensic Context

A study in mice and humans demonstrated that the GNB3 is associated with a chromatin immunoprecipitation cluster enriched in long non-coding RNAs that are up-regulated following myocardial infarction, linking it to cardiac pathological remodelling [Ounzain et al. DOI:10.1093/eurheartj/ehu180].