Basic Information

Symbol
GNG11
RNA class
mRNA
Alias
G Protein Subunit Gamma 11 GNGT11 Guanine Nucleotide-Binding Protein G(I)/G(S)/G(O) Gamma-11 Subunit Guanine Nucleotide-Binding Protein G(I)/G(S)/G(O) Subunit Gamma-11 Guanine Nucleotide Binding Protein (G Protein), Gamma 11 G Protein Gamma-11 Subunit Heterotrimeric Guanine Nucleotide-Binding Protein 3H1 HG3H1
Location (GRCh38)
Forensic tag(s)
Wound age identification Other applications

MANE select

Transcript ID
NM_004126.4
Sequence length
3019.0 nt
GC content
0.4210

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-871.75 kcal/mol
Thermodynamic ensemble
Free energy: -929.67 kcal/mol
Frequency: 0.0000
Diversity: 858.86
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((((..((((.(((((((((((((.(((.(((((((((((...))))))))))))))..(((((.((((((..((((..(((.((..(((((...((((((..((((((.((..................(((((((((.......)))))).))).((((((((((((.........))))))))))))..)).)))))).((((....)))).)))))))))))......))))))))).))))))))))).(((.(((((...))))).)))........)))))).)))))))))))..))......)))))...)))))((((((.((((.((.(((((..(((((....)))))..)))))..))..)))).))))(((((((((........))))((((.....)))).....)))))..((((((((((......((((((((.((((((((((......))))))))))..(((((.....))))).((((((((...((.(((......))).))..))))))))((((((......))))))(((((((..(((..........))).)))))))..((((.(((((..((((......))))....(((((((((....(((((...(((((((((((((((......))))))))...........((((((((((...((((((((......................))))))))))))......((.(((((.(((((......)))))(((((.....((((.(((((....(((..((((....))))..)))..)))))..))))))))).((((....))))(((((((....(((((..(.(((......))).)..))))))))).))).((((((((.(((((((((....(((((.((.(((((((((((((((...))))).........(..(((((((((.(((((........)))).).)))))))))..)(((((.(((((((.((((((.((((((((((((.....))))))..(((.(((((.(......).))))).))).........)))))))))))).))))))).)...))))...(((((((((((.((((.(((((((.............(((((....))))).)))))))..))))......(((...)))..(((((((.(((.(((.....)))))).)).....))))).)))))))))))....((((..((((((((..(((((((((..((((((((((((..(((..((((((.(((((....(((((((((((((...))))...(((((((...))))))).........))))))(((((.((((.....)))))))))...)))...))))).))))))..)))........(((((.((((((((..........)))))))).))))).((((((((((((((..((((.((.......)).))))..........((((....))))(((((..((((((((.......))))))))..)))))....(((((((......))))))).......(((((((((((.........(((((....)))))((((((((((....))).......((((((.........))))))........(((.(((.(((...)))))).))))))))))))))))))))).....((((((((.....((.((((((.(((....................))).)))))).))......))))))))...................((((((((.(((((.(((...))).))))).))))))))......))))))).....))))))).))))))))))))..........((((......)))).(((((..........((...(((..(((....(((((((((((.(((.........((.((........)).)).........)))))))).)))))))))..)))...))((.(((((((.....((((((((..(((((...(((((((((((((....(((((((.....)))))))....((((((((((((...((((((((((((((.................)))))))))..)))))...))))...((.((..(((((((.((.....)).))))))))).))....(((.((....)).))).....((((((((((....)))))))))).....(((((.(((((((.....))))))).)))))..)).))))))............((((.(((...))).))))..(((((((((...)))).)))))..)))))))))))))...)))))..)))......))))).....))))))).)).....)))))........)))))))))((((((........)).))))........)))))))).....)))).)))))))))).))....)))))......))))))))).)).))))))))))).))))))))(((((((...((.(((((........))))).))...))).)))).....))))))))))))..)))))))))...(((....))).....))))).))))..(((..(((....)))..))).))))))))))))))))))..((((((((((((...(((((((((((((((.......................................................))))))))))..........((((((((..(((..........(((((.....)))))))).)))))))).................)))))...)))))))).))))............(((((((((.......(((((((((....(((((....(((.((((((((.......))).))))).)))...))))))))))))))......))))))))).)).
Thermodynamic Ensemble Prediction
.{,,(((((((((..(({{.((,((((((((({{((({(((((((((((...))))))))))}}|{(.((((({.,,,||||||,}...,(((((((.....)))))))||.({{{{|,{{..................(((((((((......,))))))}})).((((((((((((.........)))))))))))).,}).})))||,,|||||,}},...,.|||}||||,|{{...||,..)),)}),))))))))))}|}.|),)).)))))))})}},|....|{|||||}{|||}|||||||.,||{.....|{{{{,,{{||},,.{||{.{{{{.((,((({{..(((((....))))),,|||||..||..}})).})))})))}||||,....}}}))}}{(((.....)))}....|,,((((((((({{,{{.((((((((((((...((((((((((......)))))))))).,(((({.....))))).((((((((...{,.(((......}}).))..))))))))((((((......))))))...((((((..(((((((.,.......(((((.....{({(((((..{({({(,{,{,.......(((((((({......,.}}}}}))|((,((((((((......)))))))),)},},...,}},,.,.}}}}}}}}...||||}.....,,.......,{((((((,,..,,,{(({..,..{(({({(((.,{((({{,..{{{|,|{{||||,..(((((.(((((....(((..((((....))))..))),.)))))..))))),,,,..,(({,,.,|,,({{{{{{,.,,{((((..{.{({......})).}..)))))))}).})).{{{{({((.(((((((((....(((((.((.((((((((({(((({...}}}}}............(((((((((.(((((........)))).).))))))))).,((((({,(((((((.(((((,,((((((((({{{,....))})}}..(((.(((((.(......}.))))).))),,.,.....)))))))))))).))))))}.,...,||(({.....{||.({(,,((((((((.(((((((((((((..,{{{,,,,,||||(,...,|||}..((((((((.(((...)))..{{(((((.{{{.(((.....))),}}.}},....,)))}...,,......))))))))...|}},,,....((((((((....((((((((((.{{{{,.,((((({.(({({{,,.({{{,({,,{(((,{{||||,..{||||{{.,.))))))),,},....||||.}}(((((.((((.....))))))))).}}))|...|}||}{||||}},,,}},},,,.|,(((((.((((((((..........)))))))).))))},|||,||.....,,.)),))),}||||,...,..))},..)))))))){(({....}))}(((((..((((((((.......))))))))..))))).,.,,}|}..,,},.)))))))))))))...(((((((((((,,.......,,{,,,}},},,||((((((({{,....,}}.....,.((((({.........}))))).,,.....(((.(((.(((...)))))).)))))))))))))))))))))...)))))))},}))}.}},.,|||||.,,,.....,},,.,,........|||,|,,}},.....,,.,,,,|||{........}}}}.{{{{.{{((((((((.(((((.(((...))).))))).))))))))....}),)))}....((((((((({,((({,,||...,,{||},....((((......)))).{((...(((({.{{.((((.(((((({{....{((((((((((.(((.........{{.(({{,,....))})),........)))))))).))))))))}||..{{,,..((.(((((((.....(((((,{,(((((((...(((((((((((((....(((((((.....)))))))...,(((((({({,{({{{(((,,,{{{{((((........,,,,,},..}}}|||}}|,,|||}|,,,||||...{(.((..(((((((.((.....)).))))))))),))....(((.,,....},.))).....((((((((((....)))))))))).....{{{{{.{{|||||,,,...}))))),))))}..)).))}}}}},..........((((.(({...})).))))..((((((((,...,))).)))))..)))))))))))))...))))},)),,......))))).....))))))).))....,|||},.,...,}}},...}))))).))))}}))))))))..}},,,.....))))))))))))))..,,)))))))))).))..,.}))})......))))))))).)).))))}||||,,.....,{||||{{{{,...,{,{{(({.,....,||}}}}.,,.,,}}},,,,,,)}},},,}}}}}))))}}}})))}}}}..,|{|...}))).....,)))))))||..(((..(((....)))..)))..},)))))))..))))))........(((((......))))))))))))))........))).})))))))))))..................}}},,}},.,,,||,||,|||||.,,....,.,|,,,,||}}|.|,}||,..,,.(((((.....))))).,},,,,,......,,,....(((({..(({(((((({{.{|||}||,|}..}}}}}....,{((|,(({,{({{{{{({{{{{{,,....|||||}}},|,,,||||,||,,|.,}}))})))))})}))).,,,}}}|||||||,,,...}}})))),,,,.,)).

Transcripts

ID Sequence Length GC content
AGUCCUGCAGCCCCAGCCCAGCCGUCCCCCGCGGGCGUGGCAGGUCCUG… 3019 nt 0.4210
Summary

This gene is a member of the guanine nucleotide-binding protein (G protein) gamma family and encodes a lipid-anchored, cell membrane protein. As a member of the heterotrimeric G protein complex, this protein plays a role in this transmembrane signaling system. This protein is also subject to carboxyl-terminal processing. Decreased expression of this gene is associated with splenic marginal zone lymphomas. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the GNG11 was significantly downregulated in circulating T cells during the injury stage compared to the recovery stage following major trauma [Rau et al. DOI:10.2147/JIR.S375881]. In a separate human study, the GNG11 was utilized as a marker for the manual annotation of endothelial cell clusters in a carotid atherosclerosis dataset [Xue et al. DOI:10.3233/JAD-230559].