| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCUAGCAUCCUUCAUCCUUCAGGUACCAGCCAUCCAGACAGUGCUUG… | 864 nt | 0.5602 |
Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The gamma subunit determines the specificity of which signaling pathways will be affected by this particular complex. The protein encoded by this gene represents the gamma subunit of both inhibitory and stimulatory complexes. [provided by RefSeq, Jan 2012]
A study in human traumatic brain injury (TBI) patients identified GNG3 (G protein subunit gamma 3) as a differentially expressed mRNA biomarker appearing in the cholinergic synapse and dopaminergic synapse KEGG pathways [Yang et al. DOI:10.4103/1673-5374.247467].