Basic Information

Symbol
GP1BA
RNA class
mRNA
Alias
Glycoprotein Ib Platelet Subunit Alpha Platelet Glycoprotein Ib Alpha Chain GPIbalpha CD42b Glycoprotein Ib (Platelet), Alpha Polypeptide Antigen CD42b-Alpha GP-Ib Alpha GPIbA GP1B Platelet Membrane Glycoprotein 1b-Alpha Subunit Mutant Platelet Membrane Glycoprotein Ib-Alpha Platelet Membrane Glycoprotein Ib-Alpha Glycoprotein Ib Platelet Alpha Subunit Glycoprotein Ibalpha CD42b Antigen CD42b-Alpha GPIb-Alpha BDPLT1 BDPLT3 DBPLT3 VWDP BSS
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000173.7
Sequence length
2514.0 nt
GC content
0.5537

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-831.70 kcal/mol
Thermodynamic ensemble
Free energy: -876.40 kcal/mol
Frequency: 0.0000
Diversity: 694.13
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((..(((((((((..(.(((((((((((((..(((((.............)))))(((((.(((((((((((....((..(((((((......(((((..(((..(((((.((...(((((((((..(((((((.............))))))).))......))).)))).....)).)))))...).))..))))).....))))).)).))....)))))).))))).).)))).......(((((....))).))..)))).))...)))))))))))))....((((....(((((((.((..(((((((((.(.(((...((((((.((((((.....((((((((.((.(((((.((.(.(((((.((((((...........)))).))....(((....)))(((((((....))))))).))))).).))))))).)).)))))).))..........((.(.((((.(((((((....))))....))).))))..).))........))))))))))))..)))...).))))))((.(((((....)))))))..(((((.(((((((..(((.((.((.((((((((.((..........)).)))))))))))).))).(((.((.....)))))((((((...........))))))....(((((.(((((((((((......((((((((......((......))....)))))))).......(((.(((...)))))).))))))...))))).).))))......(((.(((....))))))..((((....(((....))).....)))).))))))).))))).(((((((........))))))).))).)))))))))....)))).....(((((.((........))...)))))((((((...))))))(((((((.(((((.......))))...).)))))))))))...)))))).(((...(((...(((((((((.((((.....))))(((..(((((((.((((.(.((((.(((((((.((((((((((.(((....(((((...(((((((.(((...((.....)).......((((.........))))......)))))))))))))))..........)))))))))))))................((((.............)))).................((((((...(((((...(((...(((((....(((((...))).))(((((((..............(((((....)))))...((((((.(((((((..(((....(((((((((((((((.((..((((((((((((((..((((((((..(((.((..((.(.((((...(((((((((.(((((((.((((....(((.((.....((((.(((...........(((...))).((((.((((((((.....((((((.((.....))..)).))))..(((((.....)))))..................((((...((((.....................))))...))))((((((....(((...((((((.(((.((.(((((....((((((.((((((..(((((.............(((....(..((((.........))))..)...)))..)))))..))))))..))))))))))).)).)))))))))...)))..)).)))))))))))).))))........))).))))..)).)))...))))..))))))).....(((.((((..........(((((((.(.((((((((.((((........)))).(((((((.(..(......)..).)))))))..)))).))))).)))))))........)))))))((((((....)))))))))))..)))).))))).))..)).))).....))))))))...)))..((((((((((((((.((..((...))..)).))))).).))))))))...))))).))))))..)).))))))..(((.....))).....))))))))).....)))..))).)..))))))))).)))))..))......)))))...))).)))))............(((((...)))))(((.(((.........)))))).......))))))....((....))....)))))..))..)))).)))))..)))))))..)))..(((.(((.(((...))).))).)))............((.(((((((.(((........))).))))))))).))))))))).))).)))..(((((.((((((((((......(((((((.((.(((((((((((.(.....).))))...))))))).)).)))..........)))).....))))))))))))))).....((((((((((.....))))))))))..............
Thermodynamic Ensemble Prediction
.{{(((,,..(|(((,(((,(((((,(((,,{(((..((..((((..,.{((((((.(((((......)))))))))))}})..))))..))))).,,)))})}})},))}||||,}|||{.((((((((.((....{,.....(((((.(((((..(({.......((((....))))...((((.(((((({((((.((((..{{{{.(((.,(((....))).,))),,},..,...........{({{{{..,,)})})..)))).))).}}|({{(((((((.,.{(((((.,,((((((.{({.{{,,.,((((((.{.(((...((((((.((((((.....({((((((.((.(((((.((.(.(((((.((((({...........)))).},....(((....)))(((((((....))))))).))))).}.))))))).)).)))))).}}..........,|}|.((((.((({(((....))))....))).)))),{||,,....}},,))))))))))))..)))...}.)))))),{,((({(,,,,|||||{|,..,..|,|}.......(((.((.(,{((((((((.({..........}}.)))))))))))),)))(((((((,(.,((((((((((((...........|||||}....{||||,{{{{{{((((,....,.((((((((......(({,...,}),...)))))))).......{{{.(((...}))))}.|}||}}...}}|||,,.,}}}..,,,,{{{{{.({{{.||{|||..,,{{{,..,{({{,,,{{.{{|..,},.||||||||},,...(((((((........))))))).{((((.(((((((.,,,{.{{,,...,{{{{.||,,......,,...}}}}|((((((...))))))|((((((.{((((.......))))...).)))))),.{{....,.}}...}||.((((.....(({({.{((((((.....))))),}}.}}.,}.}}}}...))))...........((((((((({{(((....(((({..,(((((((.{{(...{{.....)}.......((((.........))))......}))))))))))))))..........))))))))))))).,,,))))))).))))|(((..........,,.}}}............,,,,,..||,........,,,,}},,}}}....}}}}}}}}})),).)}))))},|..,...,.,,.,||,,,(((((,,,.|||||,,{{{,.,,,,,,,{{{|||||.,||{({({||(((((({{{(,{.((((,,,(((((((,,,(((((((..(((,({.{((.{.((({..,((((((({,{(((((((..(({,,,,{((,((((((...(((((..{{{{{,....{(,...,}|.,,,,.{{,,{{{{....||||{...|,.....{,{((((((....,{{{{.....}}}}}................},........,,|......................}},...))))))),},.,..,|||,.{|||||}|}}}|,,(((((....((((((.((((((..(((((.............(((....{..((((.........))))..}...)))..)))))..))))))..)))))))))),,}})))}}..,},,,.}}|.,,)))}))))))||||.||||....}}}}|))}},))..}),))}...))}),.))))))),,,,,{{{.{,,...........(((((((.{.{(((((((.((((.,,..,,,}|||.{{|||||}|..|,,.,,|}..},))}}}}},,)))).)))}}.))))))).......})))))}|((((((....)))))))}}))},)))).))))).))..)).))).....))))))))...))||.((((((((((((((,({,.{,...)},,)).})))).},)))))))).,,))))).))))))..)),)))))).,{||.,,.,}}},||,.))))))))),,...}))..}}..}}))))))),)),)))))))))....)))))),.)))))))))),..,))))))))){((((...))))}({{{(((.,.....,.))))))...........,.....)))...))))).)))))..,}....)).)))))))),))))}.,|....(((.(((.(((...))).))).))),,.,{,,,....((.(((((((.(((........))).)))))))))...{|{|,,,.}))}.,{..(((((.((((((((((.,....(((((((.((.(((((((((((.{.....}.))))...))))))).)).)))..........))))...,,)))))))))))))))..}}.((((((((((.....))))))))))........,,,,},

Transcripts

ID Sequence Length GC content
AGUCCUCCAUGGGGCUAGAAGAGAGAAGGACGGAGUCGAGUGGCACCCU… 2514 nt 0.5537
Summary

Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]

Forensic Context

A study in humans demonstrated that the GP1BA gene was upregulated in peripheral blood mononuclear cells at seven days post-acute myocardial infarction, where it was involved in the platelet adhesion pathway and identified as a potential therapeutic target to improve haemostasis [Wang et al. DOI:10.1038/s41598-024-60945-3]. In a rat model of radiation-induced lung injury, single-cell transcriptomic analysis identified the orthologous rat gene Gp1ba as being associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].