| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCUCCAUGGGGCUAGAAGAGAGAAGGACGGAGUCGAGUGGCACCCU… | 2514 nt | 0.5537 |
Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]
A study in humans demonstrated that the GP1BA gene was upregulated in peripheral blood mononuclear cells at seven days post-acute myocardial infarction, where it was involved in the platelet adhesion pathway and identified as a potential therapeutic target to improve haemostasis [Wang et al. DOI:10.1038/s41598-024-60945-3]. In a rat model of radiation-induced lung injury, single-cell transcriptomic analysis identified the orthologous rat gene Gp1ba as being associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].