Basic Information

Symbol
GP5
RNA class
mRNA
Alias
Glycoprotein V Platelet Platelet Glycoprotein V CD42d Glycoprotein 5 GPV Glycoprotein V (Platelet) CD42d Antigen
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_004488.2
Sequence length
3493.0 nt
GC content
0.5594

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1310.70 kcal/mol
Thermodynamic ensemble
Free energy: -1372.88 kcal/mol
Frequency: 0.0000
Diversity: 875.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((((((((.((((((((((((((((.(((((((.......((((((((.((....))..)))))))).......)))))))....((......)).)))))))))..((((((((((((..((((..((((((((.(.(((((((......))))))).)..))))).....)))...)))).....((((........))))))))))))))))((((((..(((((((.((((..(((((((((.(((((((.((.((......(((((((.((.....((((.......))))...((((((...........)))))).....)).)))))))(((...........)))......)))).))))))).)))).....(((....((((((((..((((((.((....((((((.(....).)))))).))))))))))))))))..))))))))..)))).))))))))))))).....(((((.....))))).....((((((((...(((.((((((((((((..........((.((.....(((((......)))))....)).)).(((((((((...(((((((.(((((.........)).))).)))))))....)))).)))))..))))))))))))(((((((...)))))))(((.((...((((((.......(((....)))......)))))).....)).)))((((((.......))))))......((((....))))(((....(((((((((...)).)))))))......)))............(((.(((....((.((....)).))))).))))))...))))))))....(((((((.....))))))))))))))(((((..(((((.((.(((((((.........)))))))))..)))))..))).))((.....))...(((.(((((((((((..(((((((....))))))).))))(((((((.((.(.(((((((((((((..(((((((((.(((((((.......))))))).((((((.....(((((..((((((....(((.((((((((((((((((.(((...((.((((((((.((...((.(((.(((((((..(((((........)))))...((((((.....(((((.(((.((((.(..(((((((.(........))))))))..).)).)).)))........((((((...))))))))))))))))).))))))).))).)))).)))))))).))..)))..((((.(((.....))).)))))))))).))))))....))))))).))))))...)).))).....)))))).)))))))))))))(((((.(((((((....((((((((((..((((((.(.((.((((.((..((((((...)))))))))))).))))))((((.(((((((((....).)))...)))))...))))...((((((.((((((((((((((((.((..(((((........(((((.........)))))........)))))..)).))))).......)))).....)))))))..(((((((((((..((((.((...)).))))..))))))....)))))..(((((((............)))))))..(((((((.....)))).)))......((((((....))))))...((..((..((((...((((((((....(((...((.........)))))...))))))))))))..))..))..((((((((((.(((((((((......((((((((((((((((......((..((..(((((((((..........(((((.((.((..((((........(((((.(((((((((...(((.....(((((.((.((..((((.......))))..))..))...)))))))).))))))).).)..)))))....))))..)).)).)))))..((.(((.((....((((((((((((......)))).).))))))).)).)))))..((((((....))))))..(((((((((((((.....)))).)))))))))))))))))).))..))...(((((((......))).))))......(((((.....((((((........))))))..))))))))))))))))).)))).((((((.(((((.......(((((.(((...((((..(((((((((((((((((((((.(((.((((((((((.......)))))))))))))...))))...(((((..((.(((........(((((....)))))((((((((..(((.(((....))).)))..))))))))..............(((((((((((.(((((...((((....(((..(((.((((....(((..(((((..........)))))..))))))).))).))).)))).(((((......)))))...((((.(((......))).))))((.((((((.((((((...)))))))))).)).))...................)))))...))))).)))))).))).))..)))))..))))))).....)))))..))))))))).....))).)))))......)))))))))))....))))))..))))))))))))).....))))))..)))..)))).)))))).))))).)).)))))...((((.(((..(((((((((......(((((((..(((((((((...((((.(((......))).))))))))).....))))....((((......(((((((((..((((((((((((.((..((((...((((.((((.(((((.(((((...(((((((..((((...))))..)))).))).)))))))))).......)))).))))...((((......((((.....((((((..((.((((((((((..((((((.......((((((((.((.((((..(((...))))))).))))))))))))))))..))..)).)))))).....((((.....))))))..))))))...))))...))))(((((..........)))))..))))..)).))))))))))))...)))))))))......)))).)))))))......))))))...))).)))...)))).((((...((((((....))))))...)))).......((((..((((....)))).))))............(((((.....(((((((.((((..((((.......)))).)))))).)))))...((((((((.(..........).)))))))))))))))))))))).))))))))))..))))))))))..))))))))).))(((((......)))))..
Thermodynamic Ensemble Prediction
........(((((((((((..,.,,{(((,,,{((||{((((({.......((((((((,((...{||,,|||||}||,,.,,,,|||||||,...({,{{{..||.,|}||||||..((((((((((((,.((({,.{(((((((.(.(((((((......))))))).)..})))).}}.....,..||}}.....||{{...,},..))))}))))))))))){(((((,.(((((((,((((,,({({{((((.((((((({({.,,,,...{(((((((.{,.....((((.......))))...((((((...........)))))).....,}.)))))))|,{,..........|}|,,,,..,})).)))}))).)))}..,.,|||},,.{(((((((..(((((((((....((((((.(....).)))))).)))))))))))))))),.|||||}}}..}}}},||||}|||}}|||,....{{,||}}..}}},}},.,.,{{||{{{|.,,,,,.{(((({{(((({....,,,|,,{,,{|,,,..(((((......))))).|,|,..||.((((((((({..(((((((.(((((.........}).))).)))))))..},)))).))))).))})))))}}}}|((((((({{{|,,}|||(((.((..,((((((..((.,.(((....))).,}}..)))))}.,,..)).)))|||{{,,}}}}..)))))),...,.{{{{,...}})},|,....((((((({,...,}.))))))).....||||,............||}|,|.,,,||,,|,,,,},,|||}},})})},...))))))))||{.(({{{{||...})))))))))))}})|}|||.,|||||,|||(((({{{.........))))))))).,}}}))..))).)){|.....))...(((.(((((((((((..(((((((....))))))).))))(((((((.((.(.(((((((((((((..(((((((((.(((((((.......))))))).{(((((.....(((((..((((((....(((.(((((((((((((((((.(....((.((({{(((....))))))).))..}))))))){(({{,.((((((.(((((...(((((.((.((((.(((.((((.{..(((((((.(........}))))))),.|{||{{,{||,..,,.}}..|))}|,,{{{{||{||,|{{...,)))..)))))))),...)))).))))))).)).)))))...)))))......,)))))))},)),))))))....))))))).))))))...)).))).....)))))}.)))))))))))))|((((.(((((((.,,.((((((((((..(((((({(.,(.((((.((..((((((...))))))))))))})))))){|{|,(((((((({..,,|||||{{{||}}|,,,}}||...((({(({{{(({(((((....||}||}}}}})|},}}}.}}||||,{{{{{{...{{{,,..|}}.,.)))))}.,}}))))},......}}}}.....))))))},.(((((((((((..{{||,||,.,|}.}})),,)))))}....)))))..(((((((............))))))).,(((((((.....)))).)))......((((({....})))))...{{..{(..((((...((((((((....(((,..,,....},...),)}}...))))))))))))..}}..,,..((((((((({{(((((((((......((((((((((((((((......,{..,,..(((((((((..........(((((.((.((..((((,.....,.(((((,,{(((((((...{({.....(((({.{{,{{..,,.,,,.,.|||}}}..))}....,,)))}}))),)))))}).}.}..))))).,..))))}.)).)).)))))..((.(((.{{,...((((((({((((......)))).,.))))))).},})))))..{(((((....)))))}..(((((((((((((.....))))}}))))))))))))))))).,,..)}...(((({((......))}.))))}},...(((((.....((((((........))))))..))))))))))))))))).)))).((((((.(((((.......(((((.(((...((({.,(((((((((((((((((((((.(((.((((((((((.......)))))))))))))...)))}...((({,..((,((,..,,,,..(((((....)))))((((((((..(((.(((....))).)))..))))))))....,,.,{{{,..,,|||||{|||.(((((...((({....|||..(((.((((....(((..(((((..,....,..)))))..))))))).))).|||.}|}}.(((((......)))))...||||,|{{.,,,..}}}.)))))},||((((.((((({...}))))))))).,|,((....,,.............))))}...}}))),)}}}}}.|||.,,..))),}.,))))))).....))))}.,))))))))).....))).)))))......)))))))))))....))))))..))))))))))))).....)}})},..}))..)))).)))))).))))).)).))))|{,.((((,(((..(((((((((......(((((((..(((((((((...((((.(({......))).))))))))).....})))....((((......(((((((((,.((((((((((((.,,,,,(((((({((({,({{,.,,|,,.||||,.{(({{((.....,,))))))}}}))))))}||{|||.,||,....{{|.,,{((((.,{{{,...,}}},.)))))..,,},,.{{{{{{{{..,,||,|||,((((((.......((((((((.((.{(((,.,{,...,)})))}.)))))))))))))))}..)}..,,})}}}}}}}..,{(({..,..}}}}{((({.......))))){{.,{{{(((((..........))))).})),.}),,.)))))))))))),,.}))))))))......)))).)))))))......))))))...))).))).,.)))).}},,,(((((((({{.,{|{.(((,,{.{{.......}|||}))|||..}})))))))),......,,,...{,|||.....(((((((.((((..((((.......)))).)))))),)))))...((((((((.(,.........).)))))))).,,,,})))))))).))))))))))..))))))))))..))))))))).)){((((......))))}..

Transcripts

ID Sequence Length GC content
AGUUACUUUGGAGUGCAGAACCAUUUCAGACAUGCUGAGGGGGACUCUA… 3493 nt 0.5594
Summary

Human platelet glycoprotein V (GP5) is a part of the Ib-V-IX system of surface glycoproteins that constitute the receptor for von Willebrand factor (VWF; MIM 613160) and mediate the adhesion of platelets to injured vascular surfaces in the arterial circulation, a critical initiating event in hemostasis. The main portion of the receptor is a heterodimer composed of 2 polypeptide chains, an alpha chain (GP1BA; MIM 606672) and a beta chain (GP1BB; MIM 138720), that are linked by disulfide bonds. The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX (GP9; MIM 173515) and GP5. Mutations in GP1BA, GP1BB, and GP9 have been shown to cause Bernard-Soulier syndrome (MIM 231200), a bleeding disorder (review by Lopez et al., 1998 [PubMed 9616133]).[supplied by OMIM, Nov 2010]

Forensic Context

A study in human trauma patients demonstrated that the GP5 mRNA was significantly downregulated in circulating T cells during the injury stage compared to the recovery stage [Rau et al. DOI:10.2147/JIR.S375881]. In a separate human study on acute myocardial infarction, the GP5 gene was identified as upregulated at 7 days post-event, where it helps assess platelet activation and serves as a potential therapeutic target for improving haemostasis [Wang et al. DOI:10.1038/s41598-024-60945-3].