| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUAGAGUUGCCACCCAGGCCUCAGCCAGGACCUUUCAGGCCAGACAGGA… | 877 nt | 0.6705 |
This gene encodes a small membrane glycoprotein found on the surface of human platelets. It forms a 1-to-1 noncovalent complex with glycoprotein Ib, a platelet surface membrane glycoprotein complex that functions as a receptor for von Willebrand factor. The complete receptor complex includes noncovalent association of the alpha and beta subunits with the protein encoded by this gene and platelet glycoprotein V. Defects in this gene are a cause of Bernard-Soulier syndrome, also known as giant platelet disease. These patients have unusually large platelets and have a clinical bleeding tendency. [provided by RefSeq, Oct 2008]
A study in mice demonstrated that the GP9 mRNA was significantly dysregulated in lung tissue following 12 Gy thoracic irradiation and was functionally annotated to the hematopoietic cell lineage pathway according to KEGG analysis [Li et al. DOI:10.1177/1559325819891012].