| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGAACACUGUUGCUCUUGGUGGACGGGCCCAGAGGAAUUCAGAGUU… | 2686 nt | 0.4475 | |
| AGAAGAACACUGUUGCUCUUGGUGGACGGGCCCAGAGGAAUUCAGAGUU… | 2650 nt | 0.4487 |
The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the GPNMB identifies a prophagocytic ischemia-associated macrophage subset (MAC_Gpnmb) highly expressed at 7 days post-myocardial infarction, associated with lysosome and cholesterol metabolism pathways and exhibiting high phagocytosis and fatty acid oxidation scores, where its overexpression enhances phagocytosis in a fatty acid oxidation-dependent manner [Zhuang et al. DOI:10.1161/JAHA.122.027228]. A review further notes that the GPNMB serves as a marker for profibrotic and phagocytic macrophages, being characteristic of the MAC-Gpnmb cluster and upregulated in Bhlhe41+ macrophages during post-infarction remodeling [Bian et al. DOI:10.3892/mmr.2025.13680].