Basic Information

Symbol
GPR65
RNA class
mRNA
Alias
G Protein-Coupled Receptor 65 TDAG8 HTDAG8 T-Cell Death-Associated Gene 8 Protein G-Protein Coupled Receptor 65 Psychosine Receptor
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_003608.4
Sequence length
4511.0 nt
GC content
0.3722

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1233.70 kcal/mol
Thermodynamic ensemble
Free energy: -1320.20 kcal/mol
Frequency: 0.0000
Diversity: 1054.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((.................((((((.(((((((((.((((((....))).......(((((..(.(.(((((........(((..((.(((((.....))))).))..)))..(((((((((................))))))))).(((((......)))))....................((((((((.(((((((((.((.((((((((((.(((....)))...)))).)))))).)).))..((((........)))).((((((((((((............((((((((.....((((((((((((((.((((........))))...)))....)))).)))...))))(((.((.(((.((((...((((..(((((......)))))..))))......((((((((((..((((((((((((((((......(..((((...((((((((((((((...(((((..(((..((((..(((((((((((......(((((((..((((.((((...))))...........))))..))))))).......((.((((...((((((....(((............))).....))))))...))))))..(((((......)))))..(((.(((.(((.......))).))).))).)))))))))))..)))))))..))))).))))))).(((((...((((..((((((((((((((.(((((((((((((..((((((((((((..((((.(.....).))))...)))..(((.(((((..(((((.....)))))..(((((.(((((....(((((((((((((.........))).((((((((..((((((((((((((((((((.(((....(((((((((((((...))).))))))))))(((..(((((.((((..((((....))))((((((.......))))))))))))))).)))))).))))..))))))(((........)))..((...(((((........)))))..)).....)))))))).....))..)))))))).........(((((((((((((.(((..((((.(((...)))))..))..)))..))))))..((((((((((...((((.....((((..(((........)))))))...(((((........................)))))((((((((((.........((..........)).........))))))))))....((((((...((((((((..(((((((..((....))..))))))).))))))))))))))..((((...)))))))).)).))))))))...))))))).....))))))))))....))))))))))(((((((....))))))).(((....((((((((...))))))))...)))))))).))))))))))))..))).)).(((((.(((((........))))).)))))....................(((.(((((((........))))))).)))))))))))..((.(((((.(((((((.....(((((((.(((((((...)))))))...((((((((..((.((..((..((((((((...(((((((((((........(((....(((((((((..........((((((.((((......(((((.(((..(((((..(((((..(((.......)))..)))))...)))))))).)))))......))))))))))....)))))))))..)))..........((((((((.(((.((((((.(((((((((((((.....(((((.((..((((..((((.................(((((..((..((((.((......(((...))).......))))))))..)))))......(((((..((((((.(((....((((.....................(((((((............)))))))..(((..((((((((((....((((..................)))))))))).))))..)))))))....)))))))))...)))))............................)))).)))))))))))...............)))))))...))))))......((....))............))))))))).)))))))).....)))))))))))........(((((......))))).(((((((.((.....)).))))))).))))))))..(((((.....(((..((.((((((.(((((((((((((....((((........)))).)))))).)))))))..)))))).)).)))))))).................(((.((((.(((.......))).)))).)))........((((((((((((((((((((((((((((((((...........))))..))))))).).....))).))))))).))))))))))..))..)).))..)))))))).((((((..(((((((((((((((...)).))))))......)))))))..))))))....)))))))))))))).))))).))...)).)))))))))))).))))..))))).................)))))))...))))....)......))))))))))))))))..))))))))))...((((((...))))))......(((((..((((.(((((........)))))))))..))))).((((..((((((((...(.(((.(((((((((((((((((((((((((((((((((((((((...((((((.(((..((..(((((((.((((((((((((((((((((((((.(((((((..(((.((((((....((.((((((((((((...((((((..(((((((.(((((((((((((((((.(((.((((((((((((((((.((((((((.((((((((..((......)).))))))))..........((((......(((((((.((....(((((.................................(((((..............))))).....((((((.((....((.............................))...)).))))))))))).....))))))))).....))))...................)))))))).)))))))))))))))).))).))))))))))))))))).)))))))..))))))...)))))))))))).)))))))).)))..))))))).)))))))))))))))))))))))).)))))))..)).......))).))))))...)))))))))))))))))))))))))))))))))..........))...)))).))).)...))))))))))))))))))).)))))..)))))))).(((.(((((...((((((....(((((.((....)).)))))....(((((.(((.((((....((.(((((((....((.((((.(((....))).)))).))..))))))).))....)))).....((((.....))))))))))))....)))))).))))).)))...(((((....))))).......)))).))))))))......((((..((((((((((((...(((((..(....).)))))...)))))))))))).))))...((((((((.((.........((((((.......))))))........)).).)))))))..((((((......((((..........))))......)))))).)))))))...))))))))..))))).).)..))))).(((((((.(((((....(.(((((.(((.....((((((....))))))..(((((.....))))).......))).))))).)...))))))))))))((((((((.(((((............................))))).))))))))...((((((.(((((...((((((..((((((.....)))))).........))))))...)))))..)))...))).))).)))))))))..)))))).((((((............)))))).....))))))).))))...(((((((((......(((....................)))......)))))))))((((((((((((.((((((((((((((.....)))))).(((((((((............))))))))).............)))..)).))).)))...)))))))))...((.(((((((((...((((((.......))))))(((((((((........)))))))))...............))))))))).)).
Thermodynamic Ensemble Prediction
.(((((((((((...,,.....},...,,((((((.(((((((((.(({,,{....}},.,{{,{.,,..(((((((.,{(({..((((((((..(((((((,.,,.,({{{{{||..||{,.(((((((((................))))))))).,,,,,.....|))))}..,,...........,{{(,{(,{,........{|{{,.,,,|||,,||||,||||,{{,|}|||{||||{||||||,||.||,,,{{|.....|||}|},.(((((((((({{..........{,{{{{,{((,{{{((,{{{({{{{{(((,((((,.......}}}}.,,,|||.....||{,||{,{{{((((...((((....(({...|}}..,.)))).}}}}))),,..|}}},,||..((((((((((..((((((((((((((((......,{{((({...(|||{,,(((((((...(((((..,{(,.((((..(((((((((((......(((((((..((((.((({...})))...........))))..))))))}.......((.((((...((((((....(((............))).....))))))...))))))..(((({......})))),,(,({({(,((,.......))).))).))).)))))))))))..))))}))..))))).))))))).,{{{|...{{{{..(((((((((((((({((((((({,{({,,{((((((((((({..{(((.{....{{.}}||.,.}}}..(({.(((({..(((((.....)))))..{((((.(((({....((((((((((({{.........})).{(((((((..((((((((((((((((((((.(((....(((((((((((((...))).))))))))))(((..(((((.((((.{((((....))))|{((((.......}))}},))))))))).)))))).))))..}))))),((........}}}|,{,,,.(((((........))))).,)}.....)))))))).....))..)))))))}.........{((((((((((((.(((..((((.{{,...,}}})}.})..)))..))))))..(((((((({{...((((.....{((({.(((........))),}}}...{((((........,.....,.........))))}((((((((((.........{{..........}}.........)))))))))).,{.((((((...((((((((..(((((((..((....})..))))))).))))))))))))))..|{||,,.}}}})))).,,.))))))))...))))))}.....))))))))))....}))))))))|(((((((....)))))))}{{{....{(((((((...}))))))}...)))))))).)))))))))))}.}))).},.{((({.(((((........))))).})))}.....,,,,,|........,{((.(((((((.,,...,,))))))).))}}))))))}.|((.(((({.{((((((.....(((((((.(((((((...)))))))...((((((((..((.((..(({,(({(((((,..{((((((((((........{((....(((((((({..........((((((.((({......(((((.(({,{{{{({.,((({{..{{{.......|}},.}}}}}.,.,))}}))).)))))......}))))))))).,..)))))))))..})).}.,..,,,.((((((((.(((.((((((.(((((((((((((...,.{((((.(,.,((((..{{((.,,,,............{{(({..{{.,((((...{||....||,.,}}...,,,,{|||.,,||{........,,,.{((({..{(((({.{{{....{{{{.....................,{{{{{{.,,,....,,|,}}}}}}|..({{..((((((((((....((((..................)))))))))).))))..))))})}....)))))}}}}..|))})),|..........}}}}}.,.,,,,,...}}},.))))}))))))}},............)))))))...))))))......,.....,...,.........))))))))).))))))))},,..))))))))))).....,..,{{{,,,.,,,,}}}|.(((((((.((.....)).))))))}.)))}}))),.{((((..,,,(((..,{.((((((.(((((((((((((..,.,{{{........}})}.)))))).)))))))..)))))).,}.)))}}}}},|||,.,..........{((.{(({.{{|.......}}}.)))).))).,......((((((((((((((((((((((((((((((({.,{,.....}}))))..))))))).,..,..})).)))))))))))))))))),.))..)).))..)))))))).{{{(((.|({({{(({{{{(({{,..})}}}}))}},,,,,)))))))..)))))}..,,)))))))))))))).,)))}.)),}.})}}))))))))))).,}}}..}}}||{{{{.,,,.,,,.,,,.,,,)))}..,)))),.},),,}.,.))))))))))))))))..)))))))))).}}||||||...)))))),}}},,|)))}||||,{,{{{{{|{|{(((((((((((({....((({(((,.(((((((((...(.(((.(((((((((((((((((((((((((((((((((((((((...((((((.(((,.((..(((((((.((((((((((((((((((((((((.(((((((..(((.((((((({...(.((((((((((((.{.((((((..(((((((.(((((((((((((((((.(((.((((((((((((((((.((((((((.{(((((((,,{{.,,{{,|,.}}}}}}}|||....,,..{(((.....,{{{{{|||||,...||||{..............,........,,,.......{((({..............,}},,.....|{{{{{.,,....,,.,,.,,{.,,...................)).}})}.})))),}))))...},}}}|||||}..,,,))}}........,,.....,,,.)))))))).)))))))))))))))).))).))))))))))))))))).)))))))..)))))).}.)))))))))))),)))))))).)))..))))))).)))))))))))))))))))))))).)))))))..))......,))).))))))...)))))))))))))))))))))))))))))))))..........)},..}))).))).)...)))))))))))),)))),.})))).)))))))))..{{|,||{{|...|{|{{{....(((((.((....)).)))))....(((((,(((.{{{,...,((.(((((((....{(.((((.(((....))).)))).))..))))))).)),,,.}}},.....{{{{.....}))})}})))))....}}}))).))))).}}}..,((({{....}}))).......}))),})))))))...((((({...((((((((((((...(((((..{....}.))))).,.)))))))))))),,.,)),)))),.,},,),)))}.,,,}||||,|}}}}.,})}},,,})))))).....))))))))...}}}}.....)))))))...,}}}}{{{{{,.,,(((,.,{{{|}|||||,...,,,|}}}|,||||}|||||,}|})))|((((((.(((((....{.(((((.(((.{{{.((((((....)))))).,||{((,....}}}}},......})).))))).}...)))))))))))|((((((((.(((((.,......,.,,......,,........))))).)))))))),..,,,(({.(((((...{(((({..((((((.....)))))).........}))))}...)))))..)))...}}}.})).)))))))))..)))))).((((((............)))))).....)))))))}}}))...,((((((((..,,..(((..,.,,.......,......)))..,...))))))))}((((((((((((.((((((((.(((({.......,,}|.(((((((((............)))))))))...,.,,.,}}},)))..)).))).)))...)))))))))...({.(((((((((...((((((.......))))))(((((({{{.......,}))))))))..,,,,.........))))))))).)}.

Transcripts

ID Sequence Length GC content
AGCAGUGUUGGUUUCUCUUCUUGACUUGAUGCAGGCACAGAUUUAUCAA… 4511 nt 0.3722
Summary

Enables G protein-coupled receptor activity. Involved in several processes, including activation of GTPase activity; positive regulation of stress fiber assembly; and response to acidic pH. Located in plasma membrane. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in humans identified the GPR65 (also known as TDAG8) as a key sialylation-related gene, where its expression was significantly downregulated in sepsis-induced acute respiratory distress syndrome (ARDS) and it demonstrated robust predictive capability for this condition as part of a nomogram model with CD19 [Liu et al. DOI:10.3389/fimmu.2025.1528769]. A study in humans demonstrated that T-cell death-associated gene 8 (TDAG8) mRNA expression was significantly upregulated in the serum of patients with sepsis compared to healthy controls [Xu et al. DOI:10.3892/mmr.2022.12850]. The expression of the GPR65 showed a positive correlation with the secretion of proinflammatory cytokines and chemokines, including IL-6, IL-21, CXCL8, and MCP-1, and receiver operating characteristic curve analysis indicated its high diagnostic value for sepsis with an area under the curve of 0.952, 100% sensitivity, and 80.0% specificity.