| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGCCGCUGAGAAAGCGCAGAGAAGGCGGGCCCCGUCUGAGGUCUGGC… | 1176 nt | 0.5723 |
This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.