Basic Information

Symbol
GPX2
RNA class
mRNA
Alias
Glutathione Peroxidase 2 GSHPX-GI Phospholipid Hydroperoxide Glutathione Peroxidase GPX2 Glutathione Peroxidase 2 (Gastrointestinal) Glutathione Peroxidase-Related Protein 2 Gastrointestinal Glutathione Peroxidase Selenoprotein GPX2 EC 1.11.1.9 GSHPx-2 GPRP-2 GPx-GI GPx-2 Glutathione Peroxidase-Gastrointestinal EC 1.11.1.12 EC 1.11.1 GSHPx-GI GI-GPx GPRP
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_002083.4
Sequence length
922.0 nt
GC content
0.5423

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-315.70 kcal/mol
Thermodynamic ensemble
Free energy: -332.37 kcal/mol
Frequency: 0.0000
Diversity: 258.21
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((.(((.....((((.......)))).(((((((((...(((.((.(((.((((.((((((((((...(((.((((((...........((((.(((..((.((((........((((.((((.....))))))))....((((((((......((((((...))))))...(((.......(((((.(((....))).)))))........)))........(((((((..((((.(((((((.((......)).))).))))))))..).))))))))))))))(((((........)))))......(((((((......((.((((((..((((((..........)))))))))))))).....))))))).........((..(((((((.......((..........))........)))))))..)).((((((((.(((((......)))))..(((((((....))))))).))))))))(((((((.....)))))))......))))))..)))))))...........((((((.(.(((((..(((.((......)).)))......))))).)...)))))).....))))))))).))))))))))..)))).).)))).)))..((((..((.(((((((......(((((.....))))).......(((....)))((((((((.((((((.............))))))............((((((((((((....))))))(.((((.....((((.(((.(((((....))).))))))))).....)))).).((((((.......((((....)))))))))).)))))).))))))))))))))).))..)))))))))).))).....))).))))).))))...
Thermodynamic Ensemble Prediction
..{((((((((.(((.....((((.......)))}.((((((({(,,.(((,{({(({,((({.(((((,(((({{,(((.((({,.......,....{((({((({{,,{((((.,{(.({,(((((((,,{{...|||||,||{{{,(({((({{......((((((...))))))....(({,,,.....,|}}||}||||}}|...}||}}},....}}...,,...,(((((((..(((,,(((((((.((......)).)))}})))))))..).))))))),..||||(((((........)))))}}}}..(((((((......({,{(((((..{(((((..........))))))))))))}).,...))))))).........((..(((((((.......,,..........)}......}.)))))))..)).((((((((.(((((......)))))..(((((((....))))))).))))))))(((((((.....)))))))..,,...)))))),.,)}),),,.........{(((((.{.(((((..{{(,{{......}).,))......))))).}...)))))}.....,},||||||.,,,||||},|{{||||(,.,,))})))}}{{,|.,||...{,|||}||...(((((,...,))))).....,,||...,,}},,,.,,,|,.|||{,|}}}}}}}}.....,}}))},}}}})))),.}}},|{(((((((....)))))).)}........||||,||,|||||,}}},,}|||||||||||{{{{.|..}.,.{(((((..,,...((((....))))))))))...})}}}))))))))))))))))}}||||,,}}}})),)}).....))).))))).)))}...

Transcripts

ID Sequence Length GC content
GCUCACUCUGCGCUUCACCAUGGCUUUCAUUGCCAAGUCCUUCUAUGAC… 922 nt 0.5423
Summary

The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is predominantly expressed in the gastrointestinal tract (also in liver in human), is localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. Overexpression of this gene is associated with increased differentiation and proliferation in colorectal cancer. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]

Forensic Context

A study in human skin demonstrated that the GPX2 was significantly up-regulated in thermally injured tissue compared to normal skin, as part of a broad inflammatory and immune response during wound healing [Greco et al. DOI:10.1016/j.burns.2009.06.211]. In rats, research on blast-induced traumatic brain injury showed that the GPX2 exhibited no significant change in mRNA expression after a 5 psi blast exposure, but was part of an upregulation battery at 24 hours after a 10-11 psi blast and was also up-regulated at 72 hours following a 14-15 psi exposure, indicating its role in oxidative stress responses that are intensity-dependent [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].