| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCACUCUGCGCUUCACCAUGGCUUUCAUUGCCAAGUCCUUCUAUGAC… | 922 nt | 0.5423 |
The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is predominantly expressed in the gastrointestinal tract (also in liver in human), is localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. Overexpression of this gene is associated with increased differentiation and proliferation in colorectal cancer. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
A study in human skin demonstrated that the GPX2 was significantly up-regulated in thermally injured tissue compared to normal skin, as part of a broad inflammatory and immune response during wound healing [Greco et al. DOI:10.1016/j.burns.2009.06.211]. In rats, research on blast-induced traumatic brain injury showed that the GPX2 exhibited no significant change in mRNA expression after a 5 psi blast exposure, but was part of an upregulation battery at 24 hours after a 10-11 psi blast and was also up-regulated at 72 hours following a 14-15 psi exposure, indicating its role in oxidative stress responses that are intensity-dependent [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].