| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACGGACGGUGGCCAGGGAUCAGGCAGCGGCUCAGGCGACCCUGAGUG… | 1630 nt | 0.5589 | |
| AGACGGACGGUGGCCAGGGAUCAGGCAGCGGCUCAGGCGACCCUGAGUG… | 1603 nt | 0.5565 |
The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted, and is abundantly found in plasma. Downregulation of expression of this gene by promoter hypermethylation has been observed in a wide spectrum of human malignancies, including thyroid cancer, hepatocellular carcinoma and chronic myeloid leukemia. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
A study in mice demonstrated that the GPX3 gene, an oxidative stress marker, was up-regulated in gastrocnemius muscle following both local hind limb and distant dorsum burn injuries, with increased expression observed at 6 hours, 1 day, and 3 days post-local burn and at 6 hours, 12 hours, 1 day, 2 days, 7 days, and 10 days post-distant burn [Padfield et al. DOI:10.01.ta.0000230567.56797.6c]. A study in mice demonstrated that in vivo exposure to α-particles specifically targeting Kupffer or endothelial liver cells induced an inflammatory state, with the GPX3 being commonly up-regulated following these exposures [Roudkenar et al. DOI:10.1269/jrr.07078]. This up-regulation was part of a characteristic gene expression profile distinct from chemical hepatotoxicants, validated by real-time PCR, indicating its role in the hepatic response to radiation.