| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGGGCGGGACCUCGGGCGUGAUCGUCGAGGAGACCGCGGCUCCCUCAC… | 1184 nt | 0.4949 |
Enables protein tyrosine kinase activator activity and signaling receptor binding activity. Involved in cell surface receptor protein tyrosine kinase signaling pathway; positive regulation of MAPK cascade; and positive regulation of neuron projection development. Is active in extracellular space. [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that ultraviolet-B (UVB)-induced inflammation led to transcriptional changes in the L4 and L5 dorsal root ganglia (DRG), where the ALKAL2 was significantly up-regulated with a fold change of 6.8 [Dawes et al. DOI:10.1371/journal.pone.0093338].