| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCAGGAGGUAUUGCUGCUUCGGCGACCGGGCGGCGGCAGCGGCGGCG… | 3273 nt | 0.5185 | |
| AGCCAGGAGGUAUUGCUGCUUCGGCGACCGGGCGGCGGCAGCGGCGGCG… | 3150 nt | 0.5181 |
The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the GRB2 was more highly expressed in sepsis survivors compared to non-survivors and its expression was also elevated in subjects with VPS9D1 missense variants, which were associated with sepsis survival [Tsalik et al. DOI:10.1186/s13073-014-0111-5]. In a porcine model of cutaneous bromine injury, the GRB2 was identified as a significantly increased transcript at 7 days post-exposure, implicating its role in acute phase response and growth factor signaling pathways during wound healing [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. A study in humans demonstrated that the GRB2 was up-regulated by 18% in pericontusional brain tissue from a traumatic brain injury patient [Michael et al. DOI:10.1016/j.jocn.2004.11.003]. In a separate study investigating UVB-induced inflammation in human and rat skin, the GRB2 was identified as a direct interactor of the highly up-regulated protein SH2D5, which is involved in intracellular signal transduction in receptor tyrosine kinase pathways [Dawes et al. DOI:10.1371/journal.pone.0093338].