| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAUUCCCGGGCCAGCUUCUGUACUGCCAGGUCCGGGUCGGCGGCUGCA… | 1250 nt | 0.5704 |
This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008] CIViC Summary for GRHPR Gene
A review of forensic proteomics literature notes that the GRHPR is identified as a protein marker whose abundance increases post-mortem in cerebrospinal fluid for early post-mortem interval estimation in human studies [Alex et al. DOI:10.1016/j.scijus.2025.101320].