Basic Information

Symbol
GRIK3
RNA class
mRNA
Alias
Glutamate Ionotropic Receptor Kainate Type Subunit 3 GluK3 GLUR7 Glutamate Receptor Ionotropic, Kainate 3 Excitatory Amino Acid Receptor 5 Glutamate Receptor 7 GluR-7 EAA5 DJ1090M5.1 (Glutamate Receptor, Ionotropic, Kainate 3 (GLUR7)) Glutamate Receptor, Ionotropic, Kainate 3 GluR7a GluR7 GLR7
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000831.4
Sequence length
9491.0 nt
GC content
0.5529

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3709.30 kcal/mol
Thermodynamic ensemble
Free energy: -3874.42 kcal/mol
Frequency: 0.0000
Diversity: 2301.73
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.((....)).))(((..(((((((.(((((((.((((((((((((.((....((.....))...)).)))..((((((((.((((((((((.(((((((((((..((((((.(..(((((....)))))..).((.((((...(((((((..(((((((((..(((...((((...))))((((((..(((..(((((((((((((((((((.((.((((.....)))).))))))........((((((((((((.(((((((((.((....(.((((..(((((((...))))))))))).)...)).)))))).))).))).)))))))))....)))).).))))))))))..))).))))))...)))..)).))))))).))))))))))).))...........))))))..)))).).))))((((((((((((((.....))))))))))))))....(((((...(((((...)))))..)))))((((((((((.((((.((.(((((..(((..((((((.((((.((((((((......)))...))).)).))))))))))((((((((((...((((((.((....((........)).((((((((((((((((..........((((((.((.....)).)))..)))(((((.(((((((((((((((..........)))).)))..)))))(((.((((.(((((((.(..((.(((((.......((((((((..((((.((((((....((((.(((....((((((((((((((.....((((((.(.((.((.....))))).))))))......)).)))))))...((.(.(((...((((((((..(((((.(((.((((.(((.(((((((.((((((.....((....(((((.....))))).((.(((...))).)).....(((((((.((((((((((((((.(((((((.((.(((((.((........(((((((((.((..((((((.((......))..))))))..))(((.....(((....((((((((.(((.((........))))).))))))))....)))((((.....))))(((((((.((...((((((((((.((...(((....(((((...(((......))))))))....))))).))).)))....))))..)).)))).)))....)))...))))))).))......((((...((((((((.....((((.....))))((.((((.((....)).)))).))((.((..(((((.(((...))).)))))..)).)))))))))))))))).))))).)).)))))))))..(((((.....)))))...(((.(((......((((((((.........)))))))).......))).))).....))))))))(((...)))....((((((((.((((((((((((((((.(((......)))..)))))....((((((.((((.........)))).)))))).......(((((((((((((..(((((((.......(((((.(((((((.....(((....))).....)))))))))))))))))))..))).))))).......))))).)))))))))))))).))))).....(((...)))..((((.....)))).....((((((....)))))).)))).))))))).((((.(((((........))))).))))......))....)))))).))))))).....(((......)))..(((((..((.....)))))))((((((......)))))).))))))).))))).))).))).)))))...))).).)).))))))))))))))))))))))..))))))))(((..((....))..)))..))))).))..).))..)))).).)))))))))).).))))((((((.((((((((......(((((((...(((((((.(.....((........)).....).)))))))((((((.((............((((((..((((....))))...))))...))............))))))))(.(((((.((((((((((......((((((....((.....((((((......)))))).....))...))))))...((((((((((................(((....)))(((((((.(((..(.((((((.((......)).)))))).)(((((((((...((((((...........((((((((((..((.(((((((((...(((((..(((..((..........((((((...)))))).......))..))))))))...)))))))))....))..))))))))))..(((.........))).....((((((((((((((((.((.((....)))).))))((((((.(((.................))).))))))..((((((.((((((((((((..((..(((((.((.((........)).)).(((((.((....)))))))....)))))....)))))))))))))))))))).......((.....)).....((((........)))).(((.....)))))))))))..))))..))))))..)))))))))..(((....)))...))).)))))))........)))))))).))(((......)))))))))))))))))))...))))))))))))))))))))).)))))))))).)))))).)).))))))...))))))..)))))))...))))).)).)).)))))))))))))))))))))))).)))))))).((.((((((.(((((.......((.(.(((((((....)))))))).))...))))).)))))).))...))))))))).))))..))).)))))))..))).((((((((..((((((((((.(((..((.........((((((((((((...((.(.((((.((.(((((.(.(((..((((((((((.(((..((((((((((....)))))...(((((((((((..(((...((((..((((((((((.(.(((((((((....(((((((....))))))))))))))))..).)))).)).((((...(((.(((.(.(((..((((((((((((((((.....))..))))))....(((((.((((((.((((((((.((((...))))))))....((.((((((.((((((.((((....)))).))))....((((((.(((((((((..((((.((.((((((((......((((((.(.((((.....((((..((((.((....)).)).))..))))...(((((((((((.((((((((...(((((.(((((((.....((((((((((..(((((((.........(((((((..((.........))....))))))).....((((((((.((((..((..((.(((.(((((...........)))))))))).))..)))).....((.(((((((.((...)).))).)))).)).(((((....)))))....)))))))).((((.....))))..))))))))))))))......)))......)))))))((..((.((((((...))))))))..))))))).))))))))((((((((.....(((((..((..((((((..(((((.((.(((((((((....(((((((....(((.((..((((((((((((.((((....((..(((.((.((((..((((((.((......(((.(((....((((((((((...............))))))))))))))))))))))))...)))).)).)))..))..)).))))))))..))))))..)).)))....)))).(((((((...((((((...((((.((((((.....))...(((......))).))))))))...))))))(((((((((....))).)).))))..(((..(....)..))))))))))...)))..))))))).))..)))))))..))))))......))..)))))......))))))))..........((((((((((...(((..(((..........(((((......)))))..........))).))).)))))))))))))).)))))))(((.((((((((............)))))))).)))(((.....))).........(((.((((..(((((......))))).)))))))..)))).).))))))))))))))))))))))))))))).)))))))).))))))))......((.(((.(((((((...(((((.(.(((((...))))).).)))))(((((.....)))))........)))))))))).))...))))))))....)).))))).((((((...))))))))))))))..))).).)))))).)))))))).))))..)))(((.((((((...)))))).)))((((((........))))))...((((((............))))))...............(((((...((....)).)))))..(((.((((((((((((((...(((.((((.((((((...(((((...(((.......((((......))))))).)))))....)))))).))))...(((((((((...))).((((((((....((((((((((((.....(((....))))))))))))))).....)))))))).))))))(((.(((...))).))).)))...)))).)))))))))))))...(((.(((((((.((......)).))).)))).)))..((((((((.((((..((.((((.......))).).))..))))..(((((.............)))))...........))))))))...)))))))))))...........))).))..))).))))))))))))).).)))))...)).).........))).).))))))))))))))))..)))...(((((((..........)))))))((.(((....(((..((..(((((.(...((((((..((((((((((....))))))))))........))))))..).)))))..))..))).....)))))..((((((((.((((.....(((((.....)).))))))))))))))))))))))))).(((((((..(((((((((((((......)))))))))))))..)))))))((((((....))))))......(((((((.(((....((((......))))...))).))...)))))......))))))))((((((..((((((((((((((.(((((((.((((.((((((((......)))))))).)))))).(((((.((((((....(((((((....(.((((((.((((.(((((..((((...))))....(((.(((.(((((.(((...(((((((.((((.(((((((........))))))).).)))..)))))))...)))...(((((((((((....(((.(((((..((((..(((..(((.((....)).))).....))).))))((((((.....(((((....((((((((.(((((.....((((((...(((((((((((((((.(((.((((..(((...(((.(((((((...((((((((....(((((.((........))..)))))....))))))))..((((((..((.(((((..((.....))..))))).))..))))))(((((.(((((..((((((((.(((..(((.....(((..((.((.(((((.((((((((((((((((.......))))))))..(((((((.(((((.(((....))).)))))...))))))).....)))))))).))))))).)).)))....................)))..))).))))))))..))))).((((...))))((((((((.............(((((((((......(((((((......)))))))..((((((..((((((.(((((((((.((..((...(((.(((((...)))))))).))..)).)))..((((((.((((...)))))))))).((((((((((((((....(((((((.((((((..(.((((.(.(((((..((((....(((((((((.((((((((.........((((((((((.(.((((.(((((........))))))))).)...)))))))))))))))))).))))))))).....))))..))))).).)))))..))))))))).))))..)))))))))))))).....((((.(((..((((((((((((((.......))))))))))))))))).)))).)))))).)))))).))))))..((((((...((.(((((.((.((..(((..((..(((..(((..(((((..((((((.....)).)..)))..))))).)))..))).))....))).((((((((......)))).)))).)).)))))))))....)))))))))).)))))((((((.((((................)))).)))))).....(((..((((((...(((.(((((..........))))).)))....))))))..)))))))))))...((.(((..........))).))..)))))....)))))))))))))..)).)).))).))))))))...)))))))...))))))))))).))))))))((..((((.((((...((.((((((((((((......((((.(((((((((((....(((((((((...........((((................)))).(((((..(((((((....((((........))))..)))))))..)))))....)))))))))((.((((((.......(((((((((.((((((.(((...(((.....(((((((...(((((((((..(((..((((((((.((((((((.(((.(.((((((.((((.........)))).).)))))).))).))))...)))).))))).)))(((......))))))))))))))).((((.....))))(((((..(((....))).))))).......((((((((((((((((((((..((((......((((((.((((..((((((((((.((((((.((......(((((((............(((((......))))).(((((((((.(((((....))))).........(((((((((...(((((((...(.((((((((((((((((((((((.(((((...)))))......))))))))).........(((((((.(((((((.((((((((((......)))))...))))).)))))))...(((.((((..........)))).))))))))))...((((((((((((((((((((...((((..(((((((((((((.....))))))))))))).))))..))))))))))..(((((.((..(((((((.............)))))))..))))).))..)))))))))))))).)))).))))).)...)))))))......(((((((((....))....((((((((....)))))))).)))))))(((((.(((....))))))))(((((((((((((..(.((((.......))))).))))).).))))).)).((((.(.((((((......))))))).)))).((..((((.(((...(((...((((...........)))).)))((((((((((((((((((((((.(((..((((.((((......))))........(((((.(.((...............)).).))))).....(((((..((((..((((((((((((((((((((........))))))))))...(((((((((........))))))))).....(((...((((((....)))))).)))(((((.(((((...((((((..((..((((.((((...............)))).))))......................(((.......)))...))..))))))...))))))))))...((((((.....)))))).........)))))).))))))))..)))))...((((..(((..........))).))))))))...)))..))))).))))))..........(((((((..((((.(((((.((....)).)).....))).)))))))))))....((.((((...)))).))..))))))))))).)))))))..)))))))))))))))))))).(((.(.(((......))).).))).((((((((((.(((((.(((.(.....(((.(((........)))...)))..).)))))))).)).)))))))).....(((((((.((((((..(((((.((....)).))))).....)))))).)))))))...)))))))))))))))))))))).)))..))))..))))))))))..)))))))))))))).))))))....((((((....)).)))))))))))..))).)))..)))))).(((.((((((....((((((((((..((....))....)).).)))))))..)))))).))).((.((((((.......)))))).))....)))))))))....((......)).))))))..)))))))))))..)).)))).....)))))))))))).))..))))))))..))))))).)))))).))))))))..))))))))))).((.((((.(((...((((.((((..(((((...)))))))))))))))))))))).)))))))).)))..)))))......)))).)))......))))...)).)))))...)))))).)))))))))))))))).((((......(((((....))))).....)))).))))))))..))))))...................((((((((.(((((((((((...(((((((((((((((((((((((((.(((((((..........)))(((((((.............(((..(((.................)))...)))..))))))))))))))))).)))))..)))))).........))))))))....))))))))))).))))))))....
Thermodynamic Ensemble Prediction
.......(((,.|,(((..(((((((.(((((((.((((((((((((.((.,..((.....)).,,)),)))..((((((((.((((((((({{(((((((((((..((((((.(..(((((....)))))..).((.((((...(((((((..(((((((((..(((...((((...))))((((((..(((..((((((((((((((((((({(((((((.....))))})))}}|........|,((((((((((.(((((((((.((....,.((((..(((((((...))))))))))).)...)).))))))}})).))).)))))))))}}.))))).).))))))))))..))).))))))...)))..)))))))))).))))))))))).)),..........))))))..)))).)},)))((((((((((((((.....))))))))))))))...,{{({(,..(((((...)))))..)))))|(((((((((.{(((.((,({((({{(({..,|||||,{{{{.||{{((((......)))...))).||.|}}||,|||,((((((((((...((((((.((....,,..,.....)}.((((((((((((((((........,,{{,,,,.{{..,,.||,|||,.,,,,.|||{{{.((((((({((((..........)))).}))..))))),||.,{({{((((((((,.....,,|||}))))).((((((((,.(((,,((((((....((((.(((....((((((((((((((.....((((((.(.(,{((.....))))).))))))......)).)))))))...((.(.(((.,.((((((((..(((((.(((.((((.(((.,((((((.((((((.,,,.((,...(((((.....))))}.({,(((..,|||,|}.....(((((((.((({{(((((((((.(((((((.((.(((((..{,.......||,,,,((({(({.((((((.((......))..))))))..|{{{(..{{{(((({,.,,...|||,|||}||.|||}....,,||..,}))))),.,{||,((({.....|))}|||,,,|.,|,,.,{{{{({{{{.||{|.(((,,..(((((..{(((......))}))))).,..}}|,{{{||{{{{,,.,|,||{|,,{||{|{||,.....))}..})))),,,)),.,,}.,|||,.,|||||,,,....,((((.....))))|,.((((.((....)).)))).)}||,||,,(((((.((|...))).)))))..}).))},))))))}))))),))))).)).))))))),|,.(((((.....)))))},.(((.(((......((((((((..,....,,)))))))).....}}))).)))..}},))))))||(((...)))},..((((((((.((((((((((((((((.(((......)))..)))))....{{({((.{{{{.,,,,,...}}||,}}}})),.....,||||{((((((((.,(((({{{.||||.,((,((.(((((({.....{{{..,,))),,.,,}})))}))))||}))))))..))).)))))},..,..},,}}.)))))))))))))).)))))....,(((...}},..{{{|,,,..}}},.....((((((....)))))).}))).))))))),||||,{((((.,.....,))))}.))))......))}..})))))).))))))|,....||,......}}}..{{(({,.{|,..,.,.))}}}(({{(({{....)))).),))))))).))))).))).))).))))).,.))).).)).)))))))))))))))))))))),.)))))))).{({.{{{{..||..||,..||}||,||...,},}},}}}}}.,}},))}})},|{|{{{,{,,,,..||||||,..,,||{{{{{{{...{((((((.{.....{{........}},....}.)))))},{{((({{(.{{{{{{{{{{....{{{(..{{((,,,,|}}}...|}|},..,|...,||..,...,,}})))){,(((((.((((((((((,.....((((((({{{({.....((((({......}))}}}...,,)}}},}})))),.,,|((((((((,.......,,,.....({{....))){{{{|{{.{{{..,|(({,{({((,.,,.,|,,||||,|,.(((((((((...(((((({,{,,,.,,,,{{{,{|||||||,,.(((((((((...(((((..{{{.,{,..........((((({...}))))).......))..))))))))...)))))))))...}}.,,}|}}))}}}},,||||...,,...||,.....,.||,|||((|{{({{,,{{((({{{{.||.||,,{{((({.,|{,.......,.,.,....,}|,||}}}}..(((((,{((((((((((((..(,..(((((.((.((........)).)).(((((.,(....)})))))....)))))...,,,)))))))))))))))))).....}}}}}...}},,.||,({{{..,,,...}}}}.{{{.....))))))))))},}}),},.))))))..)))))))))..|||,.,,))},,|))).,}})))}...,,...}))))})).|||||..,,..)))))))))))))))))),...,}}}))))))))))))}))),,)))))))))).)))))).)).))))))...))))))..))))))).},))))).)).)),)}))))))))).)))))))))))).)))))))),{(.((((((.(((((...,...{({(,{((((((....))))))))}),...))))).)))))).})..,))))))))).)))}.,))).)))))))..))),((((((((.,((((((((((.{((..(({..,.....((((((((((((,,(((((((((....,}|,|})))))|{,((((((({((,(((..((((((..((((((((|,...{(.(((((((((((.{,,,...(((((.((,(((,({({(((((((((....(((((((....))))))))))))))))..,}))),}))...)).)))))..,}}..}))...((((((.,.(((......))),..))))))((((((((((.(((.({{.({.(((((((({{{{|(((({{,,..((.((((((,((((((.((((....)))).)))),,..((((((.(((((((((..((((.((.(((((((,.....{((((((.{.((((.....((((..((((.((....)).)).))..))))...(((((((((((.((((((((...(((((,(((((((.{...((((((((((..(((((((.........(((((((..((.........))....))))))).....((((((((.((((..{(,.,(.(((.(((((..{.....,..)))))))))),}}..))))...,.,(.(((((((.((...)).))).)))).)).(((((....)))))....)))))))).((((.....))))..)))))))))))))).....,)))...}}.))))))),{..((.((((((...))))))}),.}}))))).))))))))((((((((.....(((((..({,,((((({.,((((,.{{,({(((((((....{,.........(((.((,{((((((,{((((.((({....,{..(((.((.((((..((((((.({.,,...,{.{((,...{((((((((((...............))))))))))))))})))))))))...)))).)).)))..,}..}).)),)))),.,)}})))}})).))){{{{,,,|.(((((((...((((((.,.(((,{((((((.....|}...(((......))).))))))))...))))))(((((((((....))).))}}}))..|(({.,...,)},,.,))))))),..)))}.))))))).))..},},,))}}))))))..,,..))..)))))......)))))))),.........{(((((((((...(((..,{{..........(((((......)))))..,,,,....}}),))).)))))))))))))).)))))))(((.((((((((...,,.......)))))))).)))|||.....)),......,..{((.((((..(((((......))))).))))))}..)))).}.)))))))))))))))))))}))))))))).))))))}}.))))))})..,,..((,{((.(((((((.,.(((((.(.(((({...})))).).))))),|(({,,,..|},,)..,,}}..)))))))))))),.,||||,{((|,,..{{.(((((((((((((.,{{{.{{{,{||.,,..))}.}}.}}))))))))))))).,}...,})|||.|{{|||...}}||}}.}},((((((........)))))).,,}|||,,..((..((..{{{|,||{...}}}.})))..})||}},),})))}}.)).))))).,|,|.)|)))))))}|))))).(((((((.((((((....((((..,{({{,.,,,..{{{{..,...)))),,.}))))))))).))))))).)))))))))))))))))))))))))..)),(((({{(((((((.((((....(((({||,,,|,||||}},}..,..}))}}}),}))))..))))))).})))))))).{{{.....)),((.((((((.((((,..{(,(((((((((((...{(((....))))....,..)))).)))))))...{,,......,}}}})))).)))))).)){{((((((((((((({......||||.,{{{|...}})),.)}....(({{{|||.||....{{,....))).,,}},)))))).)).)))))))))).)))))))))).})))))).)),.....)))))))))))),}..}}}...{((((((.{,,...,},)))))),((.(((....(((..((..(((((.(...((((((.,{(((((((((....))))))))))........))))))..).)))))..))..}}),,...)))))..((((((((.((((.....(((((.....)).))))))))))))))))))))))))}.((((((,..(((((((((((((......))))))))))))).,})))))}((((((....))))))....,,((((({,.(((.,..((((......))))...))}.)),..)))))......))))))))((((((.,((((((((((((((.(((((,(,((((.((((((((......)))))))).))))}),(((((.((((((....(((((,{,...{.((({{({(,{{{((({(..{(({...|}}}....(((.(((.(((((.(((...(((((((.((((.(((((((........))))))).).)))..)))))))...)))...(((((((((((..((((({((((({((({...((((.,{{{(({.(((,{.{.{{{{{{.{{.{.(((((((((...,((.((((((({,(((({(,{{({{{{.(((((({{.,{{{{((((((((((,(({,{{(({{(((...,,..,||.|||}}.((((((((....(((((.((........))..)))))....))))))))..((((((..((.(((((..{(.....)}..))))).))..)))))).{{(({{,{.......(((((((((.,,(((((.(((.((.(((,.((((({(((({((({(((((((,....,})))))})},.(((((((.(((((.(({....))).)))))...))))))).....,|||||||.}}|||{{{{({{{{...,,{{|,......{,,,....{{{{,.{{,,,,....,,||),,.||}}..})}|,|,,..,........,.}}}),}}},.))))}...|||||||....{{|||||,,..((((((.{(,((((.((((((,(({,({.(({..(((.(((((...)))))))).,,.})).)),}}|(((,{(((((...)))))))))}.((((((((((((((....(((({{,{((((((..(.((((.(.(((((..((((....(((((((((.((((((((........{((((((((({.{.((((.(((((........))))))))).,...)))))))))))))))))).))))))))).....))))..))))).).)))))..)))))))}).))))..))))))))))))))...,,(({(,(({..((((((((((((((,.....}))))))))))))))))).)))).)))))).)))))).))))))....|||||}|||.,|))))}}}}..})}.}}.)))))))}|..})))))))).,,..,.,,,}))})},})),}},)))})))},||}..,...,}...,,{(((((......))))).)))}))))))))),,|.|{.,.,)},|||{..|...((((((.((((................)))).))))))..,..)))}..(((((...(((.(((((..........))))).)))....)))))|||,}.|||{||||(({....}.))),,)}},..}}.,..}}}||,....,})}}))))))}}}}))))).)),.))))))))},.)),))))}}},)}))),)))).))}))))}||}}}}}|.||}}}}}{(.((((((((((((......((((.(({((((((((....{((((((((,,,,,...,,.{(((,,....,,.....,,.||||.(((({..(((((((....((((........))))..)))))))..}))))....))))))))},{.((((((,{{{{.{({{((((((.{{{,{{.(((..,{{{....,{{{,{,|.,.(((((((({,.((({,(({(((((.((((((((.(((.(.((((((,((((.........)))).),}))))).))).))))...)))).))))).))).,,......}.})))))))))))).{(((.....)))}{{,,,.,((||,,.|}}.},}})},...,,{(((((((((((((((((((..((((......((((((.((((..((((((((((.(((((({((......(((((((............(((((......))))).(((((((({.(((({....}))))........{(((((((((...(((((((...(.((((((((((((((((((((((.(((((...)))))......))))))))).........(((((((.(((((((.((((((((((......)))))...))))).)))))))...(((.((((,......,},)}}).))))))))))...((((((((((.((((((((({..,,{,..,,,{((((((((({(((,(((((|...,)))))),)}}))))))))))|...,.|.|,.)))))))))}.......,{{{(((|....})))...))},))))))))))))))}}))).))))).)...))))))).,.,,,(((((((((..,.))....((((((((....)))))))).,}}}}}}(((((.(((....)))))))},,((((({(((((..(.((((.......))))).))))).}.))))).||.((((.(.((((((,...,.))))))).)))).{{{|{{{||.((,.{((|....{{,..,,.}}}),,}}}|.|}}((((((((((((((((((((((.(((..((((.((((......))))........(((((.{.((...........,...)}.}.))))).....{((((.,((((..((((((((({((((((((((........))))))))))...(((((((((........))))))))).....(((...((((((....)))))).))}(((((.(((((...((((({..{{.{((((.{,((..,...........})))).||||,.....,,}|}..........,{{,.......|}}...))..}))))}...))))))))))...((((((.....)))))).......,.)))))).))))))))..)))))...((((..(((.,....,,..))).))))))))...)))..))))).)))))},({{...}}}|((((((..((((.((({{.{{....}}.}}.....))).)))))))))))....((.{(((...)))).)),}))))))))))).}))))),....)))))))))))))))))).(((.(.(((......))).).))).,{((((({{{.((({(,((({(,,{,.(((.(((........}}}...},,..)}))))}))).}},))))))))},,,,|((((((.((((((..(((((.((....)).))))).....)))))).)))))))...)))))))))))))))))))))).)))..))))..))))))))))..)))))))))))))).)))))}..}|||||||},}}})})))),))))))}.},,.,}},.||}|||{{{{,(((({(,,{,{{({{{(((({{(,..,,|,{,,{||.},|||||}}..}}))}),)),.,},|||{||},,.}}})))).},)}},..)))))}})}..,,{|,,,.,..}.))))))..,,))))))))}..)).)))}.....)))))))))))).)),.||,,.,,)),,,|,|||{|,,,,..,,))))),}.))))))))))).{,{((((.(({..{(((,{((((..(((((...)))))))))))))))))))))).)))))))).)))..,,,.,,,},},)))),))},}}...)))}.,.),.)))))...)))))).)))))))))))))))).((((......(((((....)))))....,)))).)))))))).,)))))).......,,,.........((((((((.(((((((((((...((((((((({(((((({(((((((,,((({(((..........))),{{{{{{...............,.,,.,,,..,...,........,},.,,|}||,}}},})}}))))))))))}}})},,,})))),,,...,,.))))))))....))))))))))).)))))))).))}

Transcripts

ID Sequence Length GC content
GUGCGAGCCCGGGCGAUAGCAUCGGCGGCGGCUGGAGGAGGAGCGGCCG… 9491 nt 0.5529
Summary

Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. It is not certain if the subunit encoded by this gene is subject to RNA editing as the other 2 family members (GRIK1 and GRIK2). A Ser310Ala polymorphism has been associated with schizophrenia, and there are conflicting reports of its association with the pathogenesis of delirium tremens in alcoholics. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the GRIK3 gene, encoding the GluR7 kainate receptor subunit, was up-regulated in the hippocampus of alcoholics relative to controls and cocaine addicts, with an FDR-corrected P-value of 0.034 [Enoch et al. DOI:10.1111/Gbb.12179]. This differential expression pattern was also observed in the cerebellum, mediodorsal nucleus of the thalamus, and striatum in healthy brains.