| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCCUCCGGCUUCUUCACCUCUAGGAAAUCUCGGGGCUUCGCUCUAU… | 30609 nt | 0.4374 | |
| AUCCACCUUACCACCCCACUUCCCCAGCACAUGACGUGGGAAGCUGCCU… | 30802 nt | 0.4388 |
This gene encodes a member of the N-methyl-D-aspartate (NMDA) receptor family within the ionotropic glutamate receptor superfamily. The encoded protein is a subunit of the NMDA receptor ion channel which acts as an agonist binding site for glutamate. The NMDA receptors mediate a slow calcium-permeable component of excitatory synaptic transmission in the central nervous system. The NMDA receptors are heterotetramers of seven genetically encoded, differentially expressed subunits including NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The early expression of this gene in development suggests a role in brain development, circuit formation, synaptic plasticity, and cellular migration and differentiation. Naturally occurring mutations within this gene are associated with neurodevelopmental disorders including autism spectrum disorder, attention deficit hyperactivity disorder, epilepsy, and schizophrenia. [provided by RefSeq, Aug 2017]
A study in mice demonstrated that the GRIN2B gene was a hub node and a prefrontal cortex differential wiring gene enriched in synapse part annotation, associated with context-induced reinstatement of methamphetamine seeking [Hitzemann et al. DOI:10.3390/brainsci9070155]. In rats, the circular RNA circGrin2b, derived from the GRIN2B host gene, was significantly upregulated in the orbitofrontal cortex after heroin self-administration in both sexes, with its linear mRNA also upregulated in males, and this regulation was specific to heroin reward compared to sucrose [Floris et al. DOI:10.3390/ijms23031453].