Basic Information

Symbol
GRIN2B
RNA class
mRNA
Alias
Glutamate Ionotropic Receptor NMDA Type Subunit 2B GluN2B NR2B NMDAR2B Glutamate Receptor, Ionotropic, N-Methyl D-Aspartate 2B Glutamate [NMDA] Receptor Subunit Epsilon-2 N-Methyl D-Aspartate Receptor Subtype 2B N-Methyl-D-Aspartate Receptor Subunit 3 Glutamate Receptor Ionotropic, NMDA 2B HNR3 NR3 Glutamate Receptor Subunit Epsilon-2 GluN2B(Alt_5'UTR) EIEE27 DEE27 MRD6
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000834.5
Sequence length
30609.0 nt
GC content
0.4374

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-9290.57 kcal/mol
Thermodynamic ensemble
Free energy: 100000.00 kcal/mol
Frequency: inf
Diversity: 0.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((((((((....(((......((((((((((..((...(((((((((((((.....)))).)))))))))(((.((......)).)))(((((.(((((.(((.......(((((...)))))((((.........)))).......(((...)))........((((((...))))))..(((......))).......(((...))).......((((((...........))))))))).)))))))))).(((((((((..(((......))).))(((((((((((..(((((.((...)).)))))(((((((...((((((((((.(((((((........(((.........)))........)))))))((((((((....(((.......((((((((((..((((........)))).....)))).))))))........................((((..((((.((((.....(((((((..........)))))))...))))))))..))))......)))....))))))))......(((((((((....(((((..(((.......))).)))))....)))).))))).((((........)))).(((((((((...(((((.((((((.(((((((((((((.......))))))..(((((((.....(((((.(((((((.(((((((((((.......))))...)))))))..((((.((((..(((((((.((((((..((((((((((((((((....))))).....(((((.......))))).((((((.((((.((((((....)))))).))))..)))))).(((((.((.(((((........))))).)))))))......((((.(..((.((........)).))..).))))...))))..((((((((...((((.(((((..((......))..)))))))))))))))))))))))).)))))).).)))))).)))).))))...........))))))))))))...))))))).(((((....(((....))).)))))....)))).)))...)))))))))))....(((((((.((((((((.(((((.((...((....))...))...(((((((.(((.....))).))))))).......(((((((((....(((((((((.........((((((((((.((.(((.((((....)))).))).((((.((((.(((.....))).)))))))))))))))).))))((((.......)))).........)))))))))((((((.......))))))..........(((((((((........(((((((((........)))))))))...........)))))))))(((((..(((((...))))).)))))..((((((((((((...((((...((((((((((....((((((((....(.(((((.((......)).).)))).)...))))))))......(((..(((((.....(((((((.(.(((((((.(.((((.....))))....((.((((((((((..((...(((((......)))))....))...)))).....)))))).))............((..(((..(((((..(((.......)))...))))).)))..))..).))))))).).))))))).....)))))))).........))))))))))))))((....(((.(.....(((((((.....)))))))..).)))....))(((((((..((......))..)))))))..........))))))))))))....))))).)))))))))))))))))))))))).......)))))).))).....)))))))))).((((........))))...)))))))))))).).))))).(((.....)))......))))))).........))..)))).)))))).......))).))))))))))..............(((((((((((((((......)).))))))..(((.((((((...((((((..(((..((..(((((.......))))).....))..)))..((((((.....((((.(.(((......))).).))))(((((((((((((((((..(((.....(((((((((((((((.((((((...........((((((((((((((.........((((.(...((((((((((.(((...((..((((((....((((((...((((.(((((((((..(((....((((.((......)).)))).))).)))))).)))))))....)))))).))))))..))...))).))))))))))....).)))).....((((.((((((...((((((((...((((((((.((((((((....))...))))))..))))))))..(((.........)))..(((((.((........)))))))))))))))....)))))).))))))))))))))..)))))))))).....)))))))......(((((((......))).))))..)))))))).....)))..)))))))))).....((..........))((((((((((....(((........)))))))))))))....))))))).....))))))((((((((......))))).)))..)))))).)))))).))).........(((((....)))))((((...(((..........)))...))))((((((((.(((((....((((((....)))))).....)))))..))))))))..)))))))((((((....(((.((((((.((((((((.(((((......(((((((.(((...(((((.(((....((((((((((((..(((((...)))))))............)))))))))).((((((((((((((......))))...(((.((((((((((((((((((..(((((..(((((((.((((((((.....(((((..(((((((.(((((((..((((.(((((..(((.(.((..(((((((..(((.....))).)))))))..)).).)))))))))))))))))))...))))..((((.((...........)).))))....(((..((((....(((((((......)))..))))))))..)))((((((....((((..((....))..))))...((((((((((......((((....((((((((..((........))..)))............................((((...(((((((..(((((......))))).(((.....))).......((((......))))((.(((((..((((..((((((.....)))))).))))..)).))).))...).))))))....))))....)))))....))))........)))))))))).)))))).....))))))))....)))))))).)))))))...(((((((....((((((((.......(((((((.............................(((((((((((.(((((...))))).(((.((..((..((((...(((((((((.........(((((((..((((((((.((.((((......((((((((((..(((((((((((((..........((((((((.(((.((((((((((...((((......)))).).))).))))).)..)))...((((((.((.(((((((((((...)))))).................((.(((((...((((((.((..(((((....((((.....................))))......))))).)))))))).....))))).)))))))..)))))).)))))))))).....((((((....((((..((((.(((((.....(((((.((((..(((...((..((((((((.(.((((((..(((...((((((........).)))))....))).))))))).))))).)))..))....)))....)))).(((((....))))).)))))......))))).))))..)))).((((....))))(((((...........))))).)))))).......((((((((((((((...))))).....((........))))))).)))))))).)))))).)))))))))))))..(((((((.((((((.........))))))........(((((((.((((..(((((.(((.((((((.(((((.((.((.((((((.....((((((......))))))..((((........(((.(((.....))).))))))).))))))...)))).)))))..(((((.((.(.(((...))).).)).))))).............))))))....)))...)))))............(((.....((((....))))...))).....)))).)))))))...)))))))(((((.(((((..((((((.((...(((((.((((.........))))........((((((((((((((..((((.(((((((((((((...((((((((((.((((.((((((..............((((((.(((((((....................))))))).))))))......((((((.((((......(((..((((........))))..)))((((((....)))))).....))))))))))...)))))).................(((.......((((((((((((.(((.(((((.....)).))).))))))))))))))).....))))))).))))((((((....))))))..)))))).)))))).(((((((....(((.((((..(((((........))).)).)))))))(((((.....(((((((((((.((((((((....))).(((....)))((((...)))).((((((((...((.(((.(((.(((((.((((...((((((((((((...(((((((......((((.(((....))).)))).((((((((((((((((((((((((((((..(((((((((((((..((((((............))))))....))))).((((((...(((((((....)))))))))))))..((((((((((((((((((...((((((.((..((((..(((((((.(((((.((((((((((((((.(......))))))((((((((.....)))))))).))))......))))).))))))).)))))(((((.........))))).((((...((.....))...))))))))..))))))))......((((((((.(........).))))))))(((((..((.....((((((.((((((............)))))).))))))..(((((((.((..((((.(........).))))..))))))))).((((...((((((((.....))))))))...))))(((...))).))..)))))((((((((.(((((.(((((((((((((.(((..(((.((((.((((((...........)))).))))))))).......((.((((((((((...(((..((((.(......).))))..))))))))..))))).))((((.(((.(((((((.....(((.((((.......(((((.((((((....)))))).))))))))).)))(((((((((((((....).)))).))).))))).....(((((.......))))))))))))))).))))))).))))))))))))).))))).)))))))).........((((((..((((((((..((((((...(((((((((.....((((((....)))))).......(((.((((.((((.(((((........((((.((....)))))).......(((.((........)))))...(((((((........)))))))))))).))))))))))))))).)))))...))))))...........)))))))).((.((((((((((.......)).)))))))).))......((((....)))))))))).((((.(((((....((..((((((..(((.((((((.((((.........))))..((((.((...((((.(((((((((...((((((...............))))))))))))))).))))....)).))))...))))))))).))))))..))........(((((....))))).))))).))))...........(((((((........(((((((((((...))))))))))))))))))..)))))).)))).)))))..)))))))))))..))))((((((((((............)))))))..))).(((.(((((((...(((((((((....(((((....))))).(((((((....))))))).....((((....))))...((((...............)))).........(((...(((((((.....(((((((((.(((((((((.((((...(((((((((((((....................))))))).........))))))))))..((((((...((((((((.(((((...........(((.((((...)))).)))((((((((.........)))))))).((((.(.((((...)).)).).))))))))).))))))))...((......))...))))))..............))))))).)).))).)))).)).....)).))))).))))))))))))....)))))))..))).)))))))))).))))))))...)))))))))))))...)))).)))))))).))))......))))))))...))).))...))))))))............)))))..)))))))))))......)))))..))))))).....))))))).)))).)))))))...((((((((.......)))))))).(((.((((((..(((((((((............(((((.(((((((((((.(((((((.(((..((((..((((((.(((.....)))(((.(((((((......((((((((((.....)))))))))).....(((((((((.(((((((((((((((((((..............(((..(((((..((((.((.....))..........(((((((((.((((..((((..((.......(((((.((((((...((((((.......)))))))))))).)))))......))..)))))))).)))))))))(((....))))))))))))..))))))).))))))))).)).))))))))).))))...))))))))))....((((((((((((((....))))))).........(((((((((((((..(((((.((((.....(((....)))..)))).))).))..)))))))))))))(((((...............)))))....)))))))..))))))..))))...))).......))))))).)))))....((((((....(((((((......)))))))...))))))..((((((...((((.....))))))))))...(((..((((...((...........))...)))).))).....)))))).))))).(((((((.((((((((..(((....))).......(((((.(((..........)))...))))).(((.((.(((..(((((((((((.......))))))..)))))..))))))))..(((.((((((((.((....)).)))).)))).))))))))))).)))))))..))))).).)))..)))))).))))))))))((((((((....(((((((((((........(((((......)))))....((..((((((((((((((((((((((((.(((.........))))))))))..............)))))))))))....))))))..)).(((((((((((.........))))).))....))))((((((....)))))).))))))))..)))....)))))))).)))))..))...)).))))...))))))))))..(((((....((((..((..((((((((((((((.(((((((.((((((((((((.......)))))).))))))....)))).....))).)))....))))).))....))))..))..))))..)))))((((((((((.((((....((((....((((..((((((((((((....................((((((((...(((((..((((((((.(((....................)))...))))))))..)))))(((((..(((.((((((((.((((((.(((((.((((.(((..((((((......(((.....)))......))))))..........))))).)).))))).))))))........)))))))...).)).)..)))))..((((((.....(((..(((...((((((((((((.((..........)))))))))......)))))....(((((...(((((..((....(((....(((((.((((((((((((.((..((((.(((.....(.(((((..(((((((((..(((((.....)))))..((((((((((((((((((((((((((..(((((((.((((((........)))))).))))))).............(((((.((.....)).)))))....(((((((........))).))))..(((((((((.((((......)))).))...)))))))....(((((((((.....(((((((((.......))))..)))))....)))))((((((...))))))..))))((((...)))).((((....))))......(((((((((((...((((.......))))...))))))....)))))))))))...)))))))......))))).)))))))).((((......))))((((((((((.((....))....(((((((((.((((((((....((((.(((.((.((((((((((((....))))))))......((((..((((((...(((((((..(((.((..((((((((..((((((......((((((.((((.((((........(((((((......)))))))(((((.((((((((.....(((((.((..(((.....((((((((((.....)))).(((((.((((((..(((((((.....)))))))........((.((((((..((((((((((....)))))))).))..)))))).)))))))).))))).((((.((.....((((.((((((((((..(((....((.....)).......((((..((((..((...))..))))))))((((....))))(((((.(((..((((((..(((((...(((((.....)))))((((((...)))))).((((((.(((.(((..((((..((.((((.((((...((((((...(((((((((.....)))))))))...)))))).((((((.....))))))...)))).)))).))..)))).))).)))............))))))(((((.....)))))(((.((..((....))..)).)))..(((((((((((((((.((.((((.....(((((((((...........))).)))))).....))))..)).)))))...))))))))))..))))).))))))..)))..))))).)))..)))))))))))))).)).)))).....(((((..(....)..)))))(((((.......))))).((((((((..(.(((((.((..((((......))))...........(((((.((((...)))).)))))((((((.((((((((((..........)))))).................((((((((.(.(((((((.(((...((((.(((.(((((((............))))))).))).))))))))).))))).).))))))))(((((((((((((..(((...((((((((((...............((((((((...((((.((.(((((((.............((((((.....))))))..................(((((((...)))))))..((((((...(((..(((((.((.......((((((((........))))))))......)).)))))..)))))))))....))))))))).)))).)))))))).(((((((((...(((...)))...))))).))))..(((((((...)))))))....(((((((((((..(((((((.(((......))).)))).))).....)))))))))))...............))))))))))(((((...))))).(((((((((((.(((...((((((((...(((((.(((((((........(((..(((...............)))..)))((((((((((..(((..((((((((.............))))))))..((((((.((....(((((.(((((........)))))))))).))))))))...)))))))))))))))))))).)))))((((....(((...)))....)))))))))...))).))))))))))...))))))).)))))..)))))))).......)))).)))))))).))))).)..)))))))).))))))......)))...)).))))).....))))))))))))).............)))).)))).)))))).......))))))))))))))..)).)))))))))).....))))))..)))).............(((((((.((((...((((...((((.((....(((((((((((((.........))))))))..))))))).))))))))..)))).)))))))..)))))).)))..))))...)))))))).)))).))))).........))))).))))).......((((((...............((((((.(((((..((((.(((....)))))))(((((.((((.......((((..((.(((((((((((((.(((....))).)))))))....((((..((((((..((((((((((((((((((......)))))))))))))))))).))))))))))........((((((.(((((((......))))))))))))))))))).))..)))).......))))))))).......(((((((((((.(((...((((((((....(((....)))...........((((((((......))))))))..((((.(((..((.(..(.(((((.((((..((((((((((((((........((((.(((((((.(((.((((......((..(((.(((.(((((((..((((((((..((((((..........................((..(.((..(((((((((((..(.((((((...(.(((.((((.((((((.(((.(.((((((..((..((.((.....))))...((((.((..(((((((((...((...(((.....)))..............((((((((......((((.(((......((((((((((((((.(..(((((..((....(((.(((((.(((((....(((.(((((((((((((((.........((.(((((......)))))))..((((((((.(((....)))(((...))).......(((((((((((((((((((......(((((((.(((((((((((.((((((......(((.((........((((((((..((((((...((((.((((((((....(((((((.((((.(((((.((...((((.((((.(((((((.(((((((..(((((((((.......((((.((..(((((((.....(((.(.(((((.(((((((((..((((((((((.((((......))))...(((((((((((((((.(((((.((...(((.......(((((.......((((((..((((((((((.....................(((.(((((((((((.....)))..((..(((((((....((.(((....((((((......(((((((((.....(((((........)))))...........(((((.........((((.((........)).)))).(((..((((((((.......((((...(((.(..(((((((.(((.....)))(((((((((.(((((..((((((((((...((..(((....)))..))...)))...((((((((((((((((....((((.....))))........(((......)))(((((.......)))))(((((((.........)))))))(((((.(((((((((.....(((((((........(((..((((((........(((....))).(((.((((((.(((((.((..........(((((.....(((...(((((((.....(((((((.(((((..(((((...)))))......((....))..............(((((....)))))..(((.(((((.((.(((((............((((((........(((((((((.((((..((((((.(((((.((((((((((((((((...........)))))))).......((........))...((((.(((((...))))).)))).......((((..((((((.((((((........((((.((((((.((((((((.......(((((((((((.(((((((((((((((.(((((((.((((.......))))(((((((((.(((((.((((((......(((.....))).......(((((((((((((((..(((...(((.(((((((.((((.(((((((......((.((((((((((.......................(((((((((((((((..............((((.((((((.((..((((....)))).((((....))))((((.(((......))).)))).....(((((((...)))))))..........((.(((((((((...((((((((((.(((((..((((((((((......((((......))))((((.((((((((((((..(((....)))(((((....))))).((.((((((((((..((((((((........(((((......))))).......))))))))..)))).)))))).)).....((((((...))))))...((((......)))).(((((((((...(((((((.((.(((((((((((.(((((((....(((((((((.......(((((((........(((((((.....)))))))..((((((((..((((((((.(((...((((....))))(((((((.(........).)))))))...))))))))))).....))))))))..................((((((.(((((.....))))))))))).))).)))).))))))))).....)))).....)))..))))))))....))).)))))))))..))))))))).((((((...(((((((((((((((.(..((.(((...........))).))..))))..(((((.((.((((....((((.(((((.((((((....((((((((((...(((........(((((.((((((((((..((((((((.(..((...(((((((.((((((((....))))))))..............(((((..........))))))))))))..)).).)))))(((((.......((((((((...........(((((((((.((((...(((.......)))(((((((..((((((((((...(((((...)))))((((((((.((((((........)))))).))))))))..((((((((((..(((((..(((..((.((((...((((((((...........))))).)))))))))))).)))))..))))))))))((((((.((((....(((((((((.......)).)))))))....))))...))))))......)))).))))))..)..))))))........((((((((.((((((..(((((.((((((((((((((.((((..((((((((...((((((..(((..((((..((((((((........(((((..(((.((((((((.....((((((.(((...((((.......(((((..((.((...((((((((((.(((........((((...(((...))).))))....(((((....)))))....(((((((((..(((((((.......)))))))....(((.......))).....(((((((((.((((((((((((((((((((((......(((((((((..((((((((((.....))..))))))))...(((.(((.(((((..((.((((((((.....((..(((..(.(((((.....((..((((((.((((((....((((....)))).)))))).))))))..))))))).)..)))..))..))))))))..))..))))).))).)))((((((((((((((...(((.((((....(((((.(((((((.((.(((((((.(((((......))))).....((((((((((((..(((((((((.((((......(((((((.....)))))))......(((((.(((.....))).)))))....((((((...(((.((((((...))))))....)))...))))))..............((((((((((((....((((..((..(((((((.((((...((...((((((((((((((((.(((((((.(((((((.((((((((((((...))))))........)))))).)))))))....((((((((.(......(((((....((((((.(((((((((..((((((((.(((((((((.(((..(((((......))))).))))))((((.(((((..(((..(((((....(((((...(((((((((.......(((((..((.((...)).))...))))).....))))))))).((..((((....)))).))..(((((((((((((.(((((......((((((((((((...((((.......))))...)))..)))))))))))))).))))(((((.(((.(((....(.((((((((((((.((((((......(((.((((((((....(((((.(((..((........))...))))))))((..((((((..((((.....)))).))))))..)).............((((...(((((((.((((((((((((((.(((.......)))..))))))))))..))))...)))))))......))))......(((((((((..(..(((((((.......(((((((...(((((((((((.....)))))...))))))(((((.......))))).(((....))).((((.((((........))))..)))).....((((....(((((.(((((((((((((((((((((.(((((((((((((......((((........((((........))))..(((((...((((((....((.((((..((((((((....))))))))..)))).)).....))))))....))))).))))....(((((((.((((.(((((.(((((((((.(((((...)))))..))))....((((((...(((...(..((.((((((((((...(((((((...((((((((......))).))))).....(((((.....((((((((((...)))).(((((((((...(((((.(((.((......)).))).)))))..))))).....)))).(((((((((((((((((..(((..((((((((((.....(((((......))))).(((..........)))....))).)))))))....)))...)))))))))))..))).)))...)))))))))))(((((((((((((....))))))))))))))))))))..))))))))))))..)...)))...)))))).........)))))....))))))))))))))))..))))...)))))))))((((((((((((((((((((((..(((.(((((((......))).)))).))).((((((..(((.((((.....(((((...(((((.((((....))))...))))).)))))...)))).)))))))))..))))))))....))).)).))))).))))....((((((.(((((.(((((...(((((((...(((((...(((((((((((..((((((((((((..((...............((((((((...((((....(.((((((((((((......((((........))))........))))))((((...(((((((((((.((..(((....(((((((.....))))))))))..)))))).....)))))))...))))......((((((..(((((.....)))))..).))))))))))).)....))))....))))))))...............(((((.((((...)))).))))).))..))))))))).......((((.((((((((.....(((.((((....))))..))).(((((((((((.(((......((((.....)))).(((........)))............(((...(((((.........)))))..)))....))).))))))))).))(((((((((.((...(((....)))..)).)))))))))((((.......))))............((((((((((((((.....))))).))..)))))))..(((((.....))))).(((((((((((...((............))...))))))))))).........(((((((.(((((..(((..(((((..........))))).)))...))))).)))))))....)))))))).....))))(((((((((..........((((((...........)))))).))))))))).......((((((((((((((((...(((((.............))))).............))))))))........))))))))........)))..)))).))))))).)))))((((((((((((.((((((((((((((((((((.......)))).)))))))....((((......(((..((.((((..(((((((...((((.(((.....((((..(((((((((.....................)))))))))..)))).....)))..))))............(((((...)))))..)))))))..)))).))..))).......))))..(((((..........)))))........)))).))))).....((((((.....))))))..........)))))))))))).....................)))))))))))).))))).)))))).......))))))))).)))))).))))))...)))))...))))))))))))))))))((((((....(((...(((.(((((((((((((((.(((((((((((((((((.......((((((((....((((((((((((((....)))))(((((.(((..........))).))))).(((((((..(((.........((((....)))).......(((((((...(((.....)))..(((((.....)))))...............................))))))))))..))))))).))))))))).....))))))))(((((((((..(((((.((((....)))).))))).))))))))).....)))))))...((((..(((.....))).))))........((((((..(((...)))..)))))).........))))))))))..(((......)))((((.(((((((.....(((((....)))))....))))))).))))))))))(((((.....((((((.....((((...))))....))))))..((((.(((((((((.(((..((((.....))))......(((.((((((((((..(((((((((.(((....)))....))))).)))))))))))))).)))...(((((((((.....((((((((.(.((((.(((((((((.((((((......)))).(((.(..(((((.(((((((........(((.((((((((((..((.((.((((((((((......(((((........)))))((((...(((((((..((((.(((....))).))))...........))))))).....))))......(((((.(((((..((............(((........)))............)).))).)).)))))....)))))))))).))))..))))(((((((((((((.......))))).)))))))).........))))))..))))))))))...)))))..).))).....)).))))).))))..))))).))))))))((((((((.(((........)))((((((((..(((((.(((.((....)).))).)))))....)))))))).))))))))..)))))))))..(((((......))))).........)))))))))))).))))((((((...))))))..........(((((((...)))))))((.(((((......)))))))(((((.....((((...))))...))))).)))))....))))))))).)))..)))))))))............((((.(((........))))))).)..)))))))))(((((((..........((((.(((.(((((((...((((.....(((((((((((((((((((.......)))))).(((((.....((((..(((.........)))..)))).))))).........)))))..))))))))..........))))...))))))).)))..)))).))))))).)))))))))))))).))))))))))))))).).))))))...............(((((((((....)))))))))...................................))))).))))))))).....)))))...)))))...)))..))))).))))((((.((((((.((((((((......))))))))....(((((.......(((((....)))))........))))).))))))....)))).(((((((..(((((((((((((((.....(((((.......))))))))))))).((((((((((..((((......))))..((((..(((((((((((....))))))))..))).))))........(((((......................)))))........)))......)))))))...)))))))))))))))))))))))))))).......((((((((((..(((((....)))))......((((((....((.....((((..........))))....))..))))))....))))))))))..........)))))))))..)))))).....)))))).)))))))).....((((.((..((((.((((((............)))))).))))..)))))).............)))))))...))))))))))......((((.(((((((...............)))))))..))))((((....))))((((...((.....))..))))(((((((.......)))))))..................(((....)))))))))....))....)))).)))))))..))..)))).....))))))))))))........((((....)))).....)))).)))))))))...))))))).)))))...(((((.((.(((.((....)).))).)).)))))((((.(((((((((((...))))))))))).).))).....((......))....((((.((.(((((......))))).)).)))).))))))).)).))))..))).))))))))))))...)))))))))))))).(((((((...((((((........)))))).)))((((((((((.(.........).)))))))))).))))((((((((((..((((((....((((((((((((((((...(((((.....)))))((..(((((........)))))..))(.((((((..((((.....(((........))).......))))..)))))).)..(((..(((((...)))))..)))....((((....))))...........)))))))..)))))))))....))))))..)))))))))).....((((...(((((.........)))))...))))......)))))))))...)))))))).......(((........))).((((((((((((((((...(((..((..((((............))))..)).)))..)))))))))...))))))))))))))))))))).))))))).)).)))))))))))))))))).)))).....)).))..).))))))))..))))).))))...))))).))))))))))))))).))))..))))..)))..))))))..((((((....))......................((((....))))..........((((((((...((((.....))))..))))))))))))...(((.(((..((((((((((((((......(((((((((....)))........((((.....))))..........(((((.((...(((((((((((....(((..((((((((.....))))))))..)))....))))))))))).)).))))).............))))))...((((((....)))).))..))))))))))))))))).)))...)))))))).)))).)))))).......................(((((...)))))(((((((..........................)))))))..(((((((.(((.(((((((....))).))))...))).)))))))..(((...(((...........)))..)))))))))))...(((((((((.((((((....(((.....)))....))))))....)))))))))...))))).)))))))))))))).......)))).)))........)))))).((((........)))).(((((....)))))........)))))))).......)))))........)))..)))))((((((.....(((((.(((((((...........((((((((((...(((((.....(((.((((((....)))))).)))(((......)))...)))))....))))))))))....))))))).)))))..))))))......(((((((.....)))))))................((((....))))))))))))))))).))))))))))..)))))).))..........((((((..((((((...(((........)))))))))..)))))).....))))))).....)))).)).))))).)))))..)))))))))))))........))))).....))))))))))))))))))))).)))))))))))))))...))).)))))).))................)).)))))).)))))))))))))))..))))(((((((.(((....)))...)))))))....))))))(((..((.............))..)))........)))).))..)))))))))).).))))))).))).))).))))))))))).))))...))))))...))))))))))))))..(((((.(((.(.(((.((...((((.((((((...)))))).))))..)))))).))).)))))(((((.((((......)))).)))))((((....))))......(((.(((..((((.(....).))))..))).)))..))))))).))))((.(((((...)).))).))......(((((((..........))))))).........((((((((((....(((((((((....((((((.((((((.((((...))))...))))))..........))))))....)))))))))......((((((...(((((..........))))).............))))))))))))))))((((((..((........))..)))))).....((((...))))))))))))))).))))))..(((..((((((.....)))))).)))..((((((((((((((((.(((((..((((((......((((((...((((.....))))....)))))).))))))..)).))).)))...))))))).)))))))))))..))))))))..))))))))))...))).)))))))))..))))))))))))......))))))))))).)))).)))))))))))))))....))))))).))))).)))..))))).)))))))))))))).)))....))))).......)))))))))))))))).....))))))..))).((((((((.....))))))))))))))).((((...)))).....))))))))))))))...))))))).)))........)))))).)))))))))))).))))....)))))((((.(((.((((...))))))).))))..)))))))..)))).....)))).....))))))))..))))))))))))))))).......((((((((...........))))))))))))))...))).))...)))))))..))....)))))))).)))...))))))))))..)))))))))))........))).))))))).)))))).)))))))))..........((((......))))..((......)))))))))))).............)))))))))(((((((....)))))))..)))))).)))...)))))))......((((.((((((((((((.(((((((....((((((((.....))))).)))))))))).))).))))))))).)))))).))))..))))))))).)))).))).............(((....))).))))))).))))))))....)).))))))))).......)))))))........))))))))..))))......))))......((..((((((((....))))))))..))(((((((..(((..(((((((.....))))))))))...)))))))))..))))))))........)).))).....))))))))))))).....)))))))))))...)))))))))...(((((..((((((.........))))))....)))))......)))))))))).)))))))))))))).))))))))).)))..))))).))))))))(((((((((((((....)))))))..)))))).))..)))))..).))))))))))))))......))))))).......)))))))).)))))))))))..)).)))).))..))))))).))))))))))))))))).))))))..)..)))))))))))..)).)..)).)))))).(((......))).))))))))....)))))))......((((.((((((((((...)))))))))).))))))))))..))....))))))).))))))).)))).((((((.((((...))))))))))((((((........))))))((((...)))).(((((((((....(((((.......)))))..)))))))))............))))))))))))))....)))).))))).)..)))..)))))))..........))))))))))).)))))).))))))))))))))))...)))))).....)))))))))..))))).).....)))))))..)).))))).))))))).).))))))).....))))))))))))..(((.....)))(((((((((((((.....)))))))))))))...))).))).....)))))))))))))))))))).))))))..))))...))))))))..))))).)))))..)))).)).))))))))....))))))).(((((..(((...)))..))))).((((((....))))))(((((((((..((...((((((((......(((((((((..((((((((((....(((((.(((((((.....((((.(((.((((((((((((((((((((((.....((.((.((((.((((((((((((........)))...)).........))))))))))).)).)))))))))))....)))))))...((((....((((((((((((((((((((....)))))).)))))(((((((.......)))))))......)))).)))))....))))(((((((((.((((((((((((((((((((((....((((.(((((.......................(((((((......((.((.((((((((((((.((((((((((.((((((........((((((((...))).))))))))))).)))).).)))))....)))).)))))))).))...))......))))))).....(((((((((....)))))))))....(.((...(((((((...........)))))))....)).)))))))))))))))))))))(((((((...))))))).......))))))))))).((((((((((((((...............(((((.(((..((((((((..(((......((..((((((...(((..((((((((........))))))))..(((((((..((((..............))))..))).......(((.....))).........))))..)))...))))))))..)))..)))))))).)))))))).(((((....)))))((((......)))).....))))(((((..((((..((((...(((......))).)))).))))...))))).((((((....(((...((.((((((.((..(((((.((......)).)))))(((.........)))..(((((((....)))))))......((..(((((((((((........)))).)))))))..))...............))..)))))).))..))).(.(((((((....))))))).).))))))))))))))))...)))))))))(((......)))..)))))).))))))).....))))).)).)))))..))))(((((..((.((((((((((((((..(((.((((((((........))))).....)))...)))..))))...)))))....).)))).))..))))).....((((((.((...((((.(((.((..(((((((...))).))))..))))))))).)).))))))..........)))))).)))))))))...))))))))..))..))))))))))))))))))))))..))..)).))).(((((((.((.((((((((((...(((((((.....)))))))...).))))))))))).)))))))((((((((((.....................))))))).))).....(((.(((((((((((((..((......))..))))))))))))))))(((((((.(((....))).))...))))))))))))))))))))))).......))))))))(((((((((........)))..))))))....(((..((.((((((((.(((((((...((((((((((.......((.((.((...(((((.((...))))))))).)).)).......))))))))))(((.((((((((((.(((((.(((((((((((..((...((((.....(((.........(((((((.......((....)).....))))))).......)))....))))...)).))))))...))))).))..))).)))))))))).)))..((((((.((((........((((((.(.....((((((((((((.....(((((.............))))).......(((((....).))))............(((((((((.(((..(((......))).))).)))))))))((((((((((((((((((((((((((((.(((((((((((((((.....((((((((((((..((((((.(((((.((((.......((.((((((.........(((((((((((((((((((((((.(((((((((((((((.(((((((((..........(((((...(((..(((((.......))))).))))))))...........((..((((((.........))))))..))....))))))......(((((......)))))((((((((((((..((((..((((((.((.((((((((((((((.........((((((((((((((.(((((.(((.....)))(((((((((((((...)))))))..))))))......(((((((.((((((....))))((((((.((((((....(((..(((.(..((((....((....)).....))))..))))..)))......)))))).))))))......((((((.....((((((...))))))..............((((((((....)))))))).......((((.(((((....))))))))))))))).......((((.....))))(((((((.((..............))))))))).....((((((((.((((((......((.....(((.((((((...(((((.((((.........)).)).)))))..((((((....))))))...(((((((.((((((((((......)))).))))))..((((.(((((.....)))))))))....)))))))....(((((((((((...........)))))((((....))))((((.....)))).((((..((.(((((((((.....)))))))))))..))))...))))))))))))...)))))......)))))))))).)))).))))))))).....((((((((((....(((((((..(((((((((((((((.((((..(((.(((((...............................))))).)))..))))))))........(((((....(((((((......((((..((((((.(((............((((....))))(((...((((((......(((((..........)))))((((((((.....))))))))......(((....)))..)))))).))))))..))))))..))))((((((((((...))))...))))))....(((......))).........(((((((.....)))))))....))))))).))))).))))))))))).....))))))).((..((((........)))).)).........((((((.((..(((.......)))..)).)))))).......)))))))))).....(((((((...(((((......)))))))))).))..............(((((.....)))))..))))).)))..)))))))...))))........)))))))).(((((.....(((((...)))))..))))).........)))))))))))))).))))....))))))))))))...))).)))))))))))))))))))))))))))))...))))))))).........)))))))).......))))))))).))))))..))....))))))))))...))).....)))))...))))))).)))))).))))))))))))...((..((.(((((((...((((.((((((((.(((.(((...((((((((.((((....))))))))))))...)))))).)).(((((.((((.((((((....))))))...)))).)))))(((.(((.((....)).))))))......)))))).))))..))))))).))..))....((((((...((((((((((.((.((((((..(((((....(((....))))))))..))))).).)).))))))((((....)))).....))))...))))))...))))))))))(((((((((.(((((((......(((((.(((..(((((.(.((((.......))))))).......(((....)))...........)))..)))))))).....))).))...)).)))))))))..))))..))))))))..).))))))........))))))))))........(((((((((.((((......)))).))).))))))..(((...)))...(((.((((.....))))))).((((...((......)).))))...)))))))))))))))))..)))...)))))))...((((((((.......((((((...(((((.........((((.....((((((((..................)))))))).....)))))))))...)))))).......((((....((((.((((.......))))))))....))))(((((.((...((((.....((.((....))))...)))).))))))).))))))))))))).)))))))))))))))))).)))..........)))))))))).))).)))))))).))))))).((.(((.((((..((((...(((.(((((....)).))).)))...))))...)))).)))))((.((((........)))).))........((((((..(((((..(((((((((((((((.......((.((((((((......(((((((........(((...)))..))))))).)))))))).))...((....)).....)))))))))))).......((((((((.....))))))))..)))..)))))..))))))((((((.((((.((((...........(((((....((((......)))).)))))))))..))))..)))))).(((((.((.....))...)))))....)))))))).)))))...)))))))))...))))))..........(((((((....((....))....)))))))..)))))((((((.................))))))...

Transcripts

ID Sequence Length GC content
ACUUCCUCCGGCUUCUUCACCUCUAGGAAAUCUCGGGGCUUCGCUCUAU… 30609 nt 0.4374
AUCCACCUUACCACCCCACUUCCCCAGCACAUGACGUGGGAAGCUGCCU… 30802 nt 0.4388
Summary

This gene encodes a member of the N-methyl-D-aspartate (NMDA) receptor family within the ionotropic glutamate receptor superfamily. The encoded protein is a subunit of the NMDA receptor ion channel which acts as an agonist binding site for glutamate. The NMDA receptors mediate a slow calcium-permeable component of excitatory synaptic transmission in the central nervous system. The NMDA receptors are heterotetramers of seven genetically encoded, differentially expressed subunits including NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The early expression of this gene in development suggests a role in brain development, circuit formation, synaptic plasticity, and cellular migration and differentiation. Naturally occurring mutations within this gene are associated with neurodevelopmental disorders including autism spectrum disorder, attention deficit hyperactivity disorder, epilepsy, and schizophrenia. [provided by RefSeq, Aug 2017]

Forensic Context

A study in mice demonstrated that the GRIN2B gene was a hub node and a prefrontal cortex differential wiring gene enriched in synapse part annotation, associated with context-induced reinstatement of methamphetamine seeking [Hitzemann et al. DOI:10.3390/brainsci9070155]. In rats, the circular RNA circGrin2b, derived from the GRIN2B host gene, was significantly upregulated in the orbitofrontal cortex after heroin self-administration in both sexes, with its linear mRNA also upregulated in males, and this regulation was specific to heroin reward compared to sucrose [Floris et al. DOI:10.3390/ijms23031453].