Basic Information

Symbol
GRIN3A
RNA class
mRNA
Alias
Glutamate Ionotropic Receptor NMDA Type Subunit 3A GluN3A Glutamate Receptor, Ionotropic, N-Methyl-D-Aspartate 3A N-Methyl-D-Aspartate Receptor Subtype 3A Glutamate Receptor Ionotropic, NMDA 3A NMDAR-L NMDAR3A NR3A Glutamate [NMDA] Receptor Subunit 3A KIAA1973
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_133445.3
Sequence length
7838.0 nt
GC content
0.4907

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2615.90 kcal/mol
Thermodynamic ensemble
Free energy: -2756.99 kcal/mol
Frequency: 0.0000
Diversity: 1897.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.((((((((...))).))))))))))((((((((((.((((((...............((((((((.(((.((.((....................((((((..(((((((((((.(((((((((((......((((((((.((.(((((.(((((.(((((...((((((((.(.(((((((((((((...(((.(((.............(.(((((((((((................))))))))))).)((.((((((((((((..((((((((...((((..(((((((....(((((((((..((((((.((((((((((.(((.(((((...)))))(((((((.(((((((....(....)...))))))).)))))))......))))))))))((((((((((((((.....)))).)..)))))))))......))).)))))).))))((((....))))...)))))..)))))))....((((.((........)).)))).......(((((((((.(((((.(..(((((((((.....).))))))).)..).))))).))))).))))...)))).))))))))..)))))))))))))).)))))).)))))))))....)))).))))).))))((((....))))....((((((.((.((((((((((((((...((((((((.(((((.((((.(((((((((...((..(((((.(((.(((...((........))....))).))).)))))..))....)))))..))))..((((((.(...((((((((.....)))).))))....))))))).....((((((....))))))..(((.(....)))).(((((.((((((((((.((..(((..((((((((((....)))))).(((((((((.((((((....(((.((.(((.....))).))..)))((((((((....))))))))...)))))).)))))))))(((((....))))).))))..)))..))))))).....(.((((((..........))))).).)((((......))))....(((((((((((..((....))..)))..))))))))..)))))..))))).....((((((.(((((((((((..((((((((...((((.((...........))))))...)))((((((((......)))))))).(((((((.((((.(((((((((......)).))((((((....((((.(((.....))).)))).....))))))(((......)))...(((.(((((...))))))))....((((((((((((((((((((((........(((.((((((..(((((.....(((.(((((((((((....((((((..(((...((((((.(((.(((((((......((.....)))))))))(((((..(((.......))).)))))((((((((..((((......((((((((((((.((((((........((((((((((((.........(((.....))).((((((((((((.....))...)))))))))).....................))))))))))))...((((....((((.....))))))))................((((...(((((((((((((..(((...)))..))).....(((((((((.(((((((((.((..((((((.((((...)))).))))))..))...((((((.(((...((......))...))).))))))))))))......(((((((((((((((((.....(((((....))))).....))).)))..........)))).)))....))))...(((.(((.((((.((((((..((......(((......(((........((((((((((((................))))))))...)))))))....)))....))..)))))).))))))).)))(((((.....))))).))))))))))))..))))))))))))))..)))))).)))))...)))))))...)))).))))))))....))))))))).....)))....((((......))))..)))))).....((((((((((.....(((((.......)))))(((((..((((((((((((((..(((((((((....))))))).(.((((....(((.((((.(((((((..((((..(((.((((((..(((((.....(((.((((((((...))))...........((((..((((((((((((.......(((.........))).......))))))))))))..)))).....(((((((.......)))))))..............(((((.((((((((...))))))).).).))))..)))))))......)))))..)))))).))).(((.((((((.((..((((((((((((((.....))))))).........(((.......((((((((.((..(((((......))))).)))).....(((((.....(((((((.((.....)).).))))))........(((((....)))))(((((.(((.(((((((((.((.....((((((((((....(((((.((((.....(((.(((.(((((.....((.((((((..((((((((((.(......).))))).(((((((((.((((((.((.(((.((.............)).)))..)).)))))).))))).))))...(((((((((((((((........(((((....)))))...((((((((.....)))))))).))))))........))))))))).))))))))))).))..(((((((.....((((((.((..(.(((((.(((....)))..))))).)..)))))))).))))))).....((((((...))))))....((((((.(((((........))))).))))))....((.(((((...))))).))))))))))))).......)).)).)))))..)))))))))).)).).))))))))..))).))))).(((((((((((...((.....((........))....))...)))))))))))..((((((....))))))(((.(((((((((((......((((.((((..((((.((......)).)))).)))).))))((((((((....((((((.......................))))))...)))....)))))(((((((.....)))))))....((.(((((((.....))))))).)).)))))).))))).)))..)))))..(((((((.((((((((((....((((.((((((..(((((((.(((((..(((((.......))))).......((((...)))).))))))))))))...(((((((((.((......................(((.(((.((((((.......))))))..)))...)))....((((((.....))))))...))...))))))))).((((.(.((.....)).).))))...(((((......)))))(((((.(((((.....(((((...)))))...)))))..........)))))......(((......)))(((((((((((...((((((((((.((((((((.(((..((.(((...((((......))))..(((((.(((((((...)))).........((((........))))....((((((.(........).))))))))).)))))...(((.....))).))))).))))))))....)))))).))))))).)))...((((((...((((..((.((((((.....((.((....(((((....)))))....)).))....)))))))).))))...)))))).)))))))).))))))..))))...))))..)))))).)))))))..........(((((.((((.(((..(((.((.((((((....)))))).)))))))).)))).)))))...)))))).....)))))))))))).)))))).)))))))..))))))).)))).))).)))).)..))..)))))))))).)))))))))((((((((((....((((.(((((((........((((..((..((((.......))))))..))))......)))))))))))....)))))).))))..(((..((((.((((...(((.....))).)))).))))..)))(((.((((((........))).))))))(((((..(((.........(((((((......(((((((.((.(((.............))))).)))))))....))))))))))..)))))....)))))))))).................)))))))))))..))).....)))))..))))))))).(((((((...))))))).)))))....)))).))))))))..)))))(((....)))..))))))))).)))))))...))))).))))))))))).).))))))))).))))).)))))))).))....(((((...)))))..(((.(((((.((((........))))(((((((.......)))))))................(((.......))).....(((((........))))).((((((((.................))))))))))))).))).(((((((.(((((((...((((((((......(((((((((.((..........)).))))))))).))))))))....))).)).))))))))).......))))))))))))))..)))))).((((...((((..............))))...))))..............((((.......)))).....((((....))))..)))))..)))))))))).)).))))).))))))))).)).))).)).)))((((.((((....((((........))))..))))..)))).......))))))..).)))))....)).)).))).)))))))).((((((.(((((((.((................))..)))))))))...((((......))))......((((((((((....((((((((((((((((((....))))...(((((...((((((((.(((((.((((....((((((((((((((((((.((((.((..............((((....))))....(((((((.(((...(((.(((((..........(((((((((......)))))))))..(((.((((((..((..((..(((.....((((((((........(((((((((..................))))))))).....((((((......)))))).))).))))).....)))..))...))..))))))))).........))))).)))......))).))))))).....)).)))).)))))......)))))))))))))....(((((...........)))))((((..((((...)))).))))(((.........))))))).))))))))).)))))))))..............))).)))))))))))..))))))))))..))))....)))))).))))..((((((..............((.(((((((.((((((...))).))).)))))))))....))))))(((((.((((((((..((((.(((((...(((((.((((((((((((....))))..(((((...(((.((..((((....))))....)).)))....))))))))))...((((((.((......)).))))))......))))))))..))).))))))......((((((((.((((.......)))).)))))........)))....)))).))))...))))).((.(((((.......)))))..))...))))))....(((((((((.((((.((....((.(((((.....))))))))).)))).))))........((((((.(((...)))..))))))...((((((((..(((..(.(((.(((((..((((.(((((..((((((.((((((.((((((((...((((((......))))))....(((..(((......)))..))).........))))))))............(((((((((.((........))))))))))).....(((((......))))).......((((.(((((((........)))))))))))((((.......))))..((((((((((.((((.(((...(((((.(((((((((.((((((((......))))))))..((.((.....)).))((((((...((((((((.....)))........))).))....))))))...((((......))))..(((((..(((((((..(((((((......)).)))))..)))))))..)))))(((((((((((((((((((((((((.(((((((((...))))))))).))).(((((((((.....((.((........)).))((((...((((((.....))))))....)))).(((((..................)))))......)))))))))..(((((((((((((.....))))))....)))))))...((((((((((...((((((((((((..(((((((((((...(((((.....((...((((.((((.(((((((((.........)))))....((((.((((((.(((((........((.(((....((((..((((((....(((..(.....((..(.(((.((((..............)))).))).)..))....)..)))...))))))..))))))).))..(((((..((((((((((.......)))))))..))).))))).........)))))...)))))).)))).))))..))))))))...)).))))).)))))))))))))).))))(((.((((((..(((((((((((((....((.(((((..........)))))))..))).)))).))))))...((......)).......)))))).)))((.((((((((((((....(((((((((.................)))))))))........((((((((.((((......(......)......))))))))))))(((((...)))))........(((..((..........))..))).......)))))))))))))).....((((..........)))))))))..))))))))))))))))))).))))....)))))))))...........))).)))))).)))))...))).))))...))))))).)))((((((((...((((((((((.(((((((.((......)).))))...)).)..)))))))))))))))))).((((......))))))))))))))))..))))).......(((((((..((((........))))..)))))))))))....)))))))).)..)))))))))))).)))).......
Thermodynamic Ensemble Prediction
.(((((.((((((((...))),})))))))))(((((((((.(((((.(({....,,{(((((((((.{(,({(({,,,{((.{(((..(((.{....,,..((((((..(((((({(({{.{{(((((((((......((((((((.((.((({(((((((.{((((.{{{.((((((({,(,..(((((((((...(((.(((,..........,,{.(((((((((({................})))))))))).)({.((((((((((((..((((((((...((((..((((({(,...(((((((((..((((((.((,(((((((.(((.(((((...)))))(((((((.(((((((..,.(....)...))))))).)))))))......))))))))))((((((((((((((.....)))).)..)))))))))......,)).)))))).)))),,||}}|{|||,.{{||}|,{,||}||}|,.{,({{{,||.,,..,..)),})}),,}}}..||||{((((.(((((.(.,,((((((((.....).))))))).}..).))))).)))))).)))}}.)))).))))))))..))))))))))))}),)))))).))))))))).|||,,,|.|||,},)}}{((((....))))}.{.((((((.((.(((((((((((({(...((((((((.(((({.((((.(((((((((...((..(((((.(((.(((...((........))....))).))).)))))..))....)))))..))))..{{(({{.({{.((((({(({.,..,,}}.}}}},}.,})}))))}}}},((((((....))))))..(((.(....)))).(((((.((((((((((.((..(((..((((((((((....)))))).(((((((((.((((((....((({((.(((.....))).)).,))){(((((((....))))))))...)))))).)))))))))(((((....))))).))))..)))..))))))}.....,.,(((((..........))))),}},((((......))))....(((((((((((..((....))..)))..)))))))).,)))))..))))),....((((((.(((((((((((..((((((((...((((.((...........})))))...)})((((((((......)))))))).(((((((.((((.(((((,,,({,.,,..,.,,,{|||{}},.,{{({((({{,{.},|,||}}{{...||}|||{{(......)))..,||{.|{{{|,,})))))))},,},((((((((((((((((((((((........(((.((((({..(((((.....(((.(((((((((((....((((((..(((.,.((((({,((({(((((({.....,((.....))))))))}(((((..{((.......))).)))))((((((((..((((......((((((((((((.((((((.......,((((((((((((.......,,(,,....,)),.((((((((((,,.....}}...)))))))))).....................)))))))))))}}}|((({,,..({{{..,,.))))))}},...............((((...((((((((((.,{{,,{{...,}},,))|{{(((((({,,{{(((,..,||||,((..((((((.((((...}))).))))))..)}...((((((.(((...((......))...))).))))))....{,.,,,{.{|{,.{(((,{((((.{...{.(((((....))))),,}},,}.}))}..,},..}}})}}},,.,))))))))}..{((.(((.((((.(((((({.((......(((......(((........,,..{(((({{{,|.........,,...})}})))).,)))))))}....)))....,)}))))))).))))))).))}((({{.....})))).,}||||,,,}}}..))))))))))))))..)))))).)))))...)))))))...)))).))))))))..,.))))))))).....)))....((((......))))..)))))).....((((((((((.....(((((.......)))))(((((..((((((((((((((.{{.,(((({((({....(((((((..((((.{{..((.,.((((((.(((((.......(((((...((.(((.(((((.((...(((((((((((((.{{,,.,...}|.(.((((.,.((((((.((((.(((((((((((...{{(....{((((.............))))}..(((((((.......)))))))...((((..((,{.(((((.((((((((...))))))).).))}}))..)),,))))}}}.)))))))))))((((..(((((((((({.(({({,...,)))).})))))).)))))))).,,......,,.)))).)))))),.)))),,.(((((......))))).,,,,.{((((.(((((,..(((((({.((,....}),).))))))........(((((....)))))(((((.(((.(((((((({.((.....((((((((((....(((((.((((.{{..((,.(({,(((({...,.,,.{(((((..((((((((((.{......,.))))).(((((((((.((((((.((.(((.{{.............}}.)))..)).)))))).))))).))))...(((((((((((((((......,,(((({....}))))..,{((((((({....)))))))).))))))........))))))))).)))))))))))|}||,(((((((.....((((({,((..(.(((((.(((....))).|})))).}..}})))))).))))))).....((((((...})))))...,((((((.{{{{{........))))),))))))....{{.(((((...))))).}}}}))))}}}},.....}})),}).)))))..)))))))))).)).).))))))))..))).))))).(((((((((((...{{.....((........))....}}...))))))))))){{(((((,....(((((({({{((((({{((((...{{{((((.((((..((((.((......)).)))).)))).)))){(((({{(....((((((.,...........,.,.......))))))...)))....)))))(((((((.....)))))))....{{.(((((((.....))))))),||,||}}}})))))),}})}|}}}}}.,}}}}}....))))))..)})))))..||{|,{{{,.((((((((((((,((((((((((((.,........)))||,,..{|((|{(((..{(((......)))}.))))}})}............}))))))),|||,{{{.((((((.......))))))..}},........,.((((((.....)))))).,.......))))))))))...,))))),...,.))))).))))})))))))))))))..{{(((,(((({..{..(((({...}))))..,}))))..,}......}}})).......}).))))).))).))..)))))...))))).)))))),,,}..||..},,,.))))..)))))))...,)}|{{(((|.(((((((((((((.(((((......((((........))))....((((((.(........).)))))).,.....,,.(((((.((({.{{.({{,..,,.}}}).}}.,((((((((.(((((((..(((((.....((((((((.((((.((.(((.((((...((((((.,.,{(((....{((,({.,....}}.,},}}}.,)}))}.})),))).,)))).))))))))).))...))))))..)))))..((((........)))){((((.((((.(((..{({.((.((((({....}))))).))}))))).)))).))))}..))).)))).)))))))))))).)))))........))))).)))))))))))).})))))}.}))))),,)))))))))).)))))))))(((({(((((...((.{{.(((((((........((((..((..((((.......))))})..))))......))))))).}},}}..,,))))}))))..(((..((((.((((...(({.....)}}.)))).))))..)))(((.({((({......,,))).)))})){{{{|..|||.{{({{{(.((((({{.,,|..(((((((.((.(((.............))))).)))))))..,,))})))))})})})}}},,..)))))))))).................)))))))))))..))).....)))))..))))))))).(((((((...))))))).)))))....)))).))))))))..))))){{{....}}}..))))))))).)))))))...))))).))))))))))).).))))))))).})))).)))))))).}}....(((({...}))))..(((.(((((,((((.,....,.))))(((((((.......)))))))............,,,.,,,.,,,..,||,.....{{{{{..,.....))})),|(((((((.................))))))))))))).))).(((((({,(((((((...{(((((((...,,.{{(((((((.((.......,..)).)))))))}}.))))))))....))).)).))))))))).......))))))))))))))..)))))),.,,,...,,,,..........}}}}))),...,,,,..{,..........{,||.....,,,,||{,...||||....}))...)))))..)))))))))).)).))))).)))}}}}||,|}.}}}|||.|||{,{{.,|{{,..}||||,,,,....)))),,))))}.}},,.....}}))))))..).))))}.,,.,,..,}))..))))}}}.,{{{{|..,,,}}},,}},,....((((((((..{..(((((((((((((,{{({{{{{,||{...,{,,,,{(((((({.,,,({{{{(((((((({{{((....)))}..,({{{{...{(({{{{{.{((({.{{{{.,||(((((((((((((((({(,(((({{{,..,{{..,,,,.,||{,...,.,}},...{{{((({.{{{,,.{(({({(((,.,,,.....|{(((((({......}))))))}|,,(((.((((((..((..((.{(((,,,..((((((((.....,..{((((((((....,.............))))))))}.....((((((......)))))).)))}})))}...,,))).,})}..))..))))))))}....,|,..}}))}}))}.....,|||.}}}}))),}..,,}.,}}..)))}}.....,)))))))))))))....{{{{(,,,,,.....,|}},|((((..((((...)))).}}})},,,......||||||}}}.}})}}}))),))))}}}}}.........,,..|}))|))}||||}|||..||}}}}))))||,........{{.{{{..{{{{((((((........({{.,{({,{((((({.,.,{.....})},))),}))))))))....)))))),)))),)))))}.{{{({{{{{,||{..(((,.(.(((((((((((((((((((.({(((((...(((.((..((({....})))....)).)))....))))).)))))..((((((.{{......)).))))))...........((((((...(((((...((((.(((.{(((((,(,({,.,{{((({{.,((..{{{...{(......)).,}}.,,,,,.....{{.(((((.......)))))..,}{{{(({{{,.((((((((.{(((.((....(((.((((((..(((((((((((.|(((({((((.{{.......((((((.(((...)))..))))))....)))))}..,)))}.,)))))}....))))).))))))..)))...(((((((..,((((((...((((((......))))))....{{{..(({......})}..|||..,..,....,,,})))}|{{{{{({{{{(((((((((,({...,....}}}))))))}}.....(((((......))))).....{.((((.(((((((........))))))))))),,,,..|}}}}))})))|.,,,.{{{|.{.((((({{,....,}},})))).,..((((((((......)))))))).,||,,,,{(((((((((((((({,..,(((({{...,,))}..,,....}}}},}....)))))}...{(((......|||}.{(((((..{((((({,.{{{{{{(......)).)))}}..|}}))}},,}))))}.}}}}}}}||||||}}}},,.(((.(((((((({...})))))))).))).{(((((...(({{...(((.(((((({....(((((((((({,,,.{,{{|||||,{{{,{{{{{{(((,{,{((((({.....{((((,|,,..........}.}}},,(((((((((((((.....))))))....)))))))...,,||||||||.,,|||}..{{{.||||(((||||||||},}||,|||.,{{{......||}|(((....)))|||||,,,,,|{||,||.{{{{(||{|{,,......,,.....,..}},,}))),)})}}}.}}||||},},}))}}),},}}}||},.{{|,||{,..,,,......,,,}))).))).,..,,,||.|.||,..,,..,)),}}}.)))))))))}(((((..((((((((((.......))))))}..))).))))).}))))))))))))}....))))}}.,,}},,,..,.))))))))))))))).)))))))...)).)))).)))))))).)))...,|||||,{((({{....{{.|||||,{{,{{{,..},||||}..}}}}))),}))))))...,))..}).)),,))}.}})))))},}.))).))))...)))))..))))))..,.....,)))))))))).})}}}.),,))}..}}}}}}}}}))}..|||,...,}}}..,,,},)))}}}}}}}}}},,,.{{{||..,})))),,......|||..{{,,.,......)}.,))})))))))))))))..}..)))))))){(((..........)))),,)))).}))))))))))}.}}|{((..((((((((.(((((((.{,.....,,...))))))).)))),...})))..)))}})).))))).))){(((((((...{(((((((((.{((((((.((......)).))))...)).)..)))))))))))))))))}.((((......))})}.)))))).....,|,......,,..(((((((..((((.,....,.))))..)))))))..(((((((((..({{.,.,.....,,},))})))))))))...

Transcripts

ID Sequence Length GC content
AGUCGCGUUGCUCCUCCGAGGAAGCAAGCGGCGGUGGCGACUCGGUGGA… 7838 nt 0.4907
Summary

This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the GRIN3A was identified as a differentially wired gene in the prefrontal cortex associated with cell communication [Hitzemann et al. DOI:10.3390/brainsci9070155]. In cynomolgus monkeys, chronic methamphetamine and heroin exposure downregulated the GRIN3A in the hippocampus, while cocaine exposure upregulated it, with these changes in mRNA expression validated by RT-qPCR [Choi et al. DOI:10.30773/pi.2022.0004].