| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGCGCAGAGCCAGCGAGCCAGCGAGCGAGCGAGCGGGAGCCGGAGCCU… | 3356 nt | 0.6040 | |
| GAGCGCAGAGCCAGCGAGCCAGCGAGCGAGCGAGCGGGAGCCGGAGCCU… | 2224 nt | 0.6012 | |
| GAGCGCAGAGCCAGCGAGCCAGCGAGCGAGCGAGCGGGAGCCGGAGCCU… | 3514 nt | 0.5968 |
L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
A study in humans using whole blood samples from 324 individuals demonstrated that the GRM2 (GRM2) is an age-dependent DNA methylation marker, with its methylation increasing with age, and was one of 13 markers selected for a forensic age-prediction tool using massive parallel sequencing and a random forest algorithm [Naue et al. DOI:10.1016/J.Fsigen.2017.07.015]. The final model, which in some cases utilized neighboring CpG sites rather than the initial 450K array sites for markers including the GRM2, achieved a mean absolute deviation of 3.16 years and a root-mean-square error of 3.93 years on an independent test set, creating a reliable epigenetic tool for age prediction. A study in mice demonstrated that the GRM2 was used as a brain-specific surface marker for the nanomagnetic isolation of brain-derived extracellular vesicles (EVs) from plasma, enabling a diagnostic platform that achieved 99% accuracy in classifying traumatic brain injury (TBI) versus sham controls in a blinded test set [Ko et al. DOI:10.1039/c8lc00672e]. In a rat model of spinal cord contusion, real-time PCR analysis revealed that the GRM2 mRNA expression was decreased at the injury epicenter and in rostral tissue, indicating altered neuronal status following central nervous system trauma [Wu et al. DOI:10.1111/j.1471-4159.2005.03078.x].