Basic Information

Symbol
GRN
RNA class
mRNA
Alias
Granulin Precursor PCDGF PGRN Progranulin CLN11 PC Cell-Derived Growth Factor Glycoprotein Of 88 Kda Glycoprotein 88 Proepithelin Acrogranin GP88 PEPI Epithelin Precursor Granulin-Epithelin Epithelin Granulins FTD2 GEP
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_002087.4
Sequence length
2130.0 nt
GC content
0.6244

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-909.20 kcal/mol
Thermodynamic ensemble
Free energy: -947.87 kcal/mol
Frequency: 0.0000
Diversity: 489.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((.....(((((((.((.((((((.((((.(((...((((((......(((((((((((.(((((.(((((((((((((.((((((...(((((((((.(((((.((((......(((((((..(((.(((((...)))).).)))..)))))))..)))))))))....((.(((...((.(.(((.(((((..((((((((.(((((((((.(((((..(((((..((((.((((.((((.(((((.((((((((..((((.(((((.((((....(((...))).....)))).))))).)))).)))))))).))))).........((((...)))).......)))).))))..))))...((((..((....)).))))...)))))..))))).))))))))))))).........((((((......))))))........))))))))).))).).))...))).))))))))))).))).)))))))...))))))))).)))..(((((((..(((.....)))..)))))))..)).))))))))))).....))))))....(((((((((..(((.....)))......(((((.(.((....(((((((.(((((((.(((((.(((((.((.((....)).))..)))))...))..))).))))))).)))))))....)).).))))))))).)))))..(((((((....)))..))))..........)))))))))))))(((.((((.((((.......)).)).)))).)))(((((...))).)).((((..((((....)))).)))).)).)))...)))).....))).))..(((((((((..((((((.(((............(((((((((((((((((((((..........)))))))((((((.(((....(((((....)))))....))).))))))(((.((((.....))))))).((((((((.((((.......)))).)))).))))..))))...........((((((((((((((...))))).)))....)))))))))))))))).(((((.(((((((((....(((.....)))...((((((((((...((.((((((.((((........)))).)))))).))..)))))...))))))))))..((((((((..((.(((.((((((((..((((.((....))))))..((((((((...(((((((....)))))))..))))))))..((((.((((((((.(((.((..((((..(((.((.((.(((((.....))))).))....)))))..))))..)))))(((..(((.(((((((.(((.((((((((((....(((..((.((((.(((((...(((..(((.(((..((.((((((((...((.((...(((((((((...))).)))))).))))..))))))))(((((((...((((((.((((((..((.......((((((((((....((...))..)))).))))))))..)).)))).))))))))))))).(((.(.(((..((((((((((....))))).)))))....)))).))))).))).)).)..)))...)))))))))..)).)))....))))).))))).))).))))))).)))..)))..)))).))))))))((((((.((((((((.((((....))...)).)))))))))))))).....((((((...(((......))).))))))....)))))))).))).)).))))))))...........(((.((((((((......))).))))))))..))))..)))))........))).))))))...(((.........)))(((((.((((((....(((((....)))))(((.(((((((.......))))))).))).)))))).)))))((((((....)))))).(((((((.(((......(((.(......).))).(((((((..(((........)))..))))))))))))))))))))))))))(((((((.............)))))))........
Thermodynamic Ensemble Prediction
{(,((,({{{{,{{({{{,((((.,(((,((((((((({{{{.((({{((({{(,.(((({(((((.....((((((((({(((((..((.((((((.((((((((((.((((...{,.{((((((..(((.(((((...)))).).)))..))))))),.))))))))}....(((((....((((((((({..((((..((((((.(((((((((.(((((..(((((.,((((.((((.((((.(((((.((((((((..{(((.(((((.((((....(((...))).....)))).))))).)))).)))))))).)))))......,..((((...)))).......)))).))))..)))),..((((..({....)).))))...)))))..))))).)))))))))))))})).}))).((((((......)))))).((((((((((((.(((((((((((((.(({,((((({{(..(((((((.((((((((.,((((((....)).)))){,({,,..,{{{.{|||,(((((((((((((...{{,,{((((((({(,{{.(((((..((((((((.,(((((((((({.....{((((.{.((....(((((((.(((((((.(((((.((({{.{{.(({.,....).}}))}}).,.))..))).))))))).)))))))....)).).))))))})))).))).{(((((((.,..||,....)).....|}}}..}))}.(((((.((((...(((.....(((((,....{(((((((((....{...({(.{(,((((....,...{((((..{{,.....}),..))))))}}}...})).,.})))))))))))))))..)))....))))..)))))))).),)))))(((((((..........)))))))((((((.(((....(((((....)))))....))).)))))))}).})))}((((..((.....))..)))),))))}}.....)))))))}))))))))))))))}|||,}},((((((((((((((...))))).)))....)))))).,{||,|.(({{{.{{,........},.)}.,})}.}.)}}...,...,,((((...((.((((((.((((........)))).)))))).))..)))))))))))).))))))){((((.....(((.((.(((.....))).)).)))....)))))..((((((((...(((((((....)))))))..))))))))|{{{{{,(,((,,,....}},),|})||,|.{{{.,{{{.((({(.....))))).))})}.}}})})))))))).)))))))))))))))))}}.(((((((((((((.((((((.....)))))).,}}).))))||.||||||.,,,...,||||||{,}}|,.((.|,(((((((((...)))}}))))).))})}.)))))))}(((((((...((((((.((((((..{{.,,,.,.((((((((((....,,...)}..))))}})))))}}..)).)))).))))))))))))).,},,,))))))}))))(((((....)))))))))).....))))){{{{{,{.{,......,}}.))))}}))))))))).)),))..)))))||((((((.(((.....))).)))))).},,,,}}}}}}}}),,,.||}}|||,||}}}}||}}}.))}.})))))))|{(((((((((..({(,.(((.{{((({({{({({{.|||||,.,,{{{|||(,{(({|{,,,..))))))}}}....,))},}})|,}),)))..,}}.})))))))))))))..)))...))))))))).))............{{,.........}))(((((.((((((....(((((....)))))(((.(((((((.......))))))).))).)))))).)))))((((((....)))))).......))))..))).))}},|}..,,.,,)).((((((((..(((........)))..))))))))}},))))}}}}}},))))(((((((.............)))))))........

Transcripts

ID Sequence Length GC content
GCUGCUGCCCAAGGACCGCGGAGUCGGACGCAGGCAGACCAUGUGGACC… 2130 nt 0.6244
Summary

Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.