| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUCUCUCAUGACCCCGCUCCGGGAUUAUGGCCGGGACUGGGCUGCUGG… | 970 nt | 0.6485 |
Predicted to enable dioxygenase activity and metal ion binding activity. Involved in DNA damage response and regulation of mitochondrial membrane permeability involved in programmed necrotic cell death. Located in mitochondrial matrix. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the ALKBH7 as one of 14 age-associated mRNAs selected from peripheral blood samples, with its expression showing a correlation with age, and these markers were used to build a forensic age estimation model where a random forest algorithm demonstrated optimal predictive performance [Jin et al. DOI:10.3389/fgene.2022.924408]. In a separate bioinformatics analysis of human platelet transcriptomes from acute myocardial infarction patients, the ALKBH7 was identified as a hub gene within a co-expression module associated with extracellular space and calcium binding in a specific patient subtype [Zhang et al. DOI:PMC8129354].