Basic Information

Symbol
ALKBH7
RNA class
mRNA
Alias
AlkB Homolog 7 SPATA11 Alpha-Ketoglutarate-Dependent Dioxygenase AlkB Homolog 7, Mitochondrial Alkylated DNA Repair Protein AlkB Homolog 7 Spermatogenesis-Associated Protein 11 Spermatogenesis Associated 11 MGC10974 ABH7 Probable Alpha-Ketoglutarate-Dependent Dioxygenase ABH7 Spermatogenesis Cell Proliferation Related Protein Spermatogenesis Cell Proliferation-Related Protein AlkB, Alkylation Repair Homolog 7 (E. Coli) AlkB, Alkylation Repair Homolog 7 EC 1.14.11.- UNQ6002
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_032306.4
Sequence length
970.0 nt
GC content
0.6485

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-442.70 kcal/mol
Thermodynamic ensemble
Free energy: -460.56 kcal/mol
Frequency: 0.0000
Diversity: 147.51
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((.((((...)))).))))))..))))(((((((.((((((..((....)))))))))))))))(((((((((((((.((((((((...(((((.((((((..((.....(((((.(((((((((((.((((.((.(..(.((((..((.........))..)))).)..).)))))).).)))))))))).)))))..............((((((.((((((......))))...(((((((((....((((((.((((....((((.((.((((..((((.(((((((((((((.((..((.((((((....))))))....))...)).)).))))))))))).)...))).)))))))))).......(((((.((.((((........)))))).))))).)))).)).)))))))))))))..)).)))))).))...)))))).).))))....))).)))((((((((((((((........(((((((((((((.((((((......))))))...))))))(((((........))))).((((....))))((((....))))...(((((((....).))))))((((.(((((.(((.....))).))))).))))((((((.((((..((.(((((((...((((.(...(((.(((((((........((((((((((.(((((((....).))))))...))))))))))...((.(((((..((((........))))))))))).))))))).)))....).))))....)))....)))).)).)))).))))))))))))).((((((((((((......)))))..))))))).((((((...((((((((........)))).)))).))))))...)))).))))))))))...))..))))).))))))))........................
Thermodynamic Ensemble Prediction
.,{,.,{(((((.((((...)))).))))))..))),(((((((.((((((,.{,....)),))))))))))))(((((((((((((.((((((((...(((((.{((((({,({{.{{,(((((.(((((((((((.((({{((.{..(.((((..((..,....}.))..)))).)..}.)))))).).)))))))))).)))))..,{....,,....((((((.((((((......))))...(((((((((....((((((.((((..,.((((.(,{((((..(((,.(((((((((((((.(({.(,.((((((....))))))....))...)).}}.))))))))))).,...))).)))))))))).......(((((.((.((((........)))))).))))).)))).))}}))))))))))))..)).)))))).)),.,)))))),),))))....))).)))((((((((((((((........(((((((((((((.((((((......))))))...)))))).,,,{.,,,{{{,|,,||,{{{{.,.,))),||{{,,..,,}}...(((((((....).))))))((((.(((((.(((.....))).))))),)))}((((((.((((.,((.(((((((...((((.{...(((.(((((((..,,....((((((((((.(((((({....}.))))))...))))))))))...,{.(((((..((((.,....,.)))))))))),.))))))).)))....}.))))....)))....)))).)).)))).))))))))))))).((((((((((({......})))),.})))))).((((((.{{,(((((((........)))),)})).))))))...)))))}}))))))))...))..))))).))))))))........................

Transcripts

ID Sequence Length GC content
CCUCUCUCAUGACCCCGCUCCGGGAUUAUGGCCGGGACUGGGCUGCUGG… 970 nt 0.6485
Summary

Predicted to enable dioxygenase activity and metal ion binding activity. Involved in DNA damage response and regulation of mitochondrial membrane permeability involved in programmed necrotic cell death. Located in mitochondrial matrix. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans identified the ALKBH7 as one of 14 age-associated mRNAs selected from peripheral blood samples, with its expression showing a correlation with age, and these markers were used to build a forensic age estimation model where a random forest algorithm demonstrated optimal predictive performance [Jin et al. DOI:10.3389/fgene.2022.924408]. In a separate bioinformatics analysis of human platelet transcriptomes from acute myocardial infarction patients, the ALKBH7 was identified as a hub gene within a co-expression module associated with extracellular space and calcium binding in a specific patient subtype [Zhang et al. DOI:PMC8129354].