Basic Information

Symbol
GSTA2
RNA class
mRNA
Alias
Glutathione S-Transferase Alpha 2 Glutathione S-Transferase A2 GST2 GST Class-Alpha Member 2 GST HA Subunit 2 EC 2.5.1.18 GST-Gamma GSTA2-2 GTH2 Testis Tissue Sperm-Binding Protein Li 59n S-(Hydroxyalkyl)Glutathione Lyase A2 Glutathione S-Aralkyltransferase A2 Glutathione S-Alkyltransferase A2 Glutathione S-Aryltransferase A2 Liver GST2 GTA2
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000846.5
Sequence length
1221.0 nt
GC content
0.4013

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-303.40 kcal/mol
Thermodynamic ensemble
Free energy: -327.00 kcal/mol
Frequency: 0.0000
Diversity: 346.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((.....(((((((((((..........)))..(((....)))..((((.((((((...)))))).(.(((....))).)....))))....((((((((((((((((((.(((((((.(((((((((((((.((.((((((((((((......)))))....((((((.....))))))(((((((.((((......(((.(((((..((((((.((...((.((((((((((((...((((.......(((((....)))))..)))))))))))..))))).)))).......(((((((((.......((...(((.......)))...)).......))))).))))...(((((...((((......))))....)))))...((((.....))))))))))))))))))..)))).)))).)))...................)))))))...))((((((.......)))))).((((...(((((.....)))))))))..((.((((.((((((.(((...)))))))))(((((((((.((((..((((.((((.....)))).(((((.....((((........))))))))).(((.....)))...(((....))).)))))))).)))))))))..)))).))))))))..))).)))).))...))))).(((((((((.((....))...)))))))))..(((((....)))))((((((((((((........((((((((.((....))...))))))))((((((((..((((.....)))).)))))))))))).)))))..)))..((((....))))(((((.....)))))..........))))).))))............((((((((.(((....((((((...)))))).))).))))))))........................(((((((((...(((((.............((((((((.....)))))))))))))....))))))))).)))))))))...((((..(((.(((.............))).)))))))....((((..(((((.....)))))..))))((((((((((...........(((.((((.........)))).)))))))))))))....))))))))....))).((((.(((((......))))).))))........
Thermodynamic Ensemble Prediction
{{{..({{...,,||||||,((,,,....,,.|||,.(((....)))..((((.((((({...}))))).(.(((....))).,....}}}}....((((((((({...(((((({{({{,||(((((|{(((((({(..((((((({{{{({.,,,....}||....{(({{,,...}}}||((((((((.((((......(((.(((((..((((({.{{..,{(,{{{(((((((((...((((.......(((((....)))))..)))))))))))},})))),,.}}.......(((((((((,.....,(,,,.(((.,....,}}}...},.......}}})},})))...(((((...((((......))))....))))),,,||||,,...}}}}))}}}}|}})}))}..)))).)))).)))},,..............,.}}}}}}},}}}}{{{{{,...,,},}},}}),|||},}}|{{{|,,,.,)||||||||.....(({,.(((((((((.....,...,}||(((((((((.((((..((((.((((.....)))).(((((.....((((........))))))))).(((.....)))...{{{....})}.)))))))).)))))))))..)))))))))))){{{.|||.,,,,})..})),{({((({(((((.{{....|}...)))))))))},(((((....))))).,||||||||||........{(((((((.{{....))...)))))))}((((((((.{((((.....})))|)))))}}}},,},||}}},|}}}..{{||.,..}))},|||,..,}},.},,..,,,,,...,),},.,,}}....,,,}}},,{{{{{|||.|||,||.{{{(((,,.}}|||}.|||.}}}}}})),..,,),.,}}}}})))),,,,..(((((((((...(((((,,,.......,|,((((((((.....)))))))))))))....))))))))),))))))))).....,...{{{|,,,.............|||||,.|||,....((((..(((((.....)))))..))))((((((((((...........|{{.{{{{.,.....,.)})}.)))))))))))))....}}}}}|||,,..,}),}|||.(((({......))))).}})),.......

Transcripts

ID Sequence Length GC content
GUCCAGCCACAAAGGUGACAGCAUUUAACAAAGCUUAGAGAAACCUCCA… 1221 nt 0.4013
Summary

Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes function in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding these enzymes are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of some drugs. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, located in a cluster mapped to chromosome 6, are the most abundantly expressed glutathione S-transferases in liver. In addition to metabolizing bilirubin and certain anti-cancer drugs in the liver, the alpha class of these enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the GSTA2 was significantly altered in expression in liver tissue on day 7 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].