Basic Information

Symbol
GSTA4
RNA class
mRNA
Alias
Glutathione S-Transferase Alpha 4 Glutathione S-Transferase A4 Glutathione S-Transferase A4-4 GST Class-Alpha Member 4 EC 2.5.1.18 S-(Hydroxyalkyl)Glutathione Lyase A4 Glutathione S-Aralkyltransferase A4 Glutathione S-Alkyltransferase A4 Glutathione S-Aryltransferase A4 Glutathione Transferase A4-4 GSTA4-4 GTA4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_001512.4
Sequence length
1240.0 nt
GC content
0.4242

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-329.80 kcal/mol
Thermodynamic ensemble
Free energy: -356.47 kcal/mol
Frequency: 0.0000
Diversity: 216.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((((.((...((.((.(.((((((.((.(((.......))).))..((((((((((((((..(((.((..(((...(((......)))...)))....))))).)))))))).))))))...)))))).).)).))......(((((((((..(((((((.((.((((.......(((((.(((...)))))))).......)))).)).....((((((.(((((.(((((((.((((((((((((((((......(((((((((((..(((...((.....(((((((((........))))))))).....))..)))..))))).))))))((((((...((.(((.((((..((((.(((((....................))))).))))..((((((((.((((.((((((.....))))))..)))).))).)))))..........((((((((.((((....(((....((((((((((((.((.(((.(((.....((((((((.(((.(((..........(((((....)))))...........))).))).)))))))).(((((.......)))))....))))))......(((.......)))..(((((......)))))...)).))))))))..)))).)))))))..)))))))).(((.(((....)))))).((((((((((.((((..((.(((((....)))))..)).....))))..))))))))))......))))))))).))))))...(((.(((((((..(((((((......))))).))..))))))))))....)))))))...)))))))))....))))))).))....))).)))))))))))))))))).)))).......(((((((((((((((((..........(((((((((((....((((.......(((...((((((.........))))))...)))........((((((..(((((((((...............(((((......)))))....(((((......))))).....))))))))))))))).))))......))))))))).))..((((....((((....))))...)))).))))))))).)).)))))))))))))))...........((((((((.(((......))).)))).))))..))))))...............
Thermodynamic Ensemble Prediction
..((((((((((({,((...((.((.(.((((((.((.(((.,....,))).)).{((((((((((((((..((({((..{((,,.(((......)))..,))},...))))).)))))))).))))))}..)))))).).)).)}.,,,..(((((((({.,(((((((.((.((((.......(((((.(((...)))))))).......)))).)).....((((((.(((((.(((((((.((((((((((((((((.....,(((((((((((..(((.{,{(.....(((((((((........))))))))).....})}.)))..))))).))))))|(((((,{{(,,{{{.,(((..(((..,,,..}}},,,..........,,}}}}},|{{||{..((((((((.{(({.((((((.....))))))..}))}.)))}}}))).))}}}}}..((((((((,((((....(({....((((((((((((.{{.{{,{,.{,{...((((((((.(((.(({..........{{((,.{{,|,,,)}}}..,,....})}.))).}))))))).,{{{{.......})))},,,.,|||,..,,}..|||.......,....{{{{{.,.,..)))))...)),))))))))},.})).)))))))..)))))))).{(({{{{....})}})}.((((((((((.((({..{{,(((((,...|))))..))....,))))..))))))))))....,}}}}})}}}},)))}||...(((.(((((((..(((((((......))))).))..))))))))))...,))))))),..,))))))))....))))))).))....))).)))))))))))))))))).))))..,,...(((((((((((((((((.......,,,(((((((((((....((((...{{..{((.,.((((((.........)))))).,.)))........((((((..(((((((((...............(((((......)))))....(((({......})))).....))))))))))))))).))))......))))))))).}|.,,...,,,|((((....)))}.}.))}..))))))))).)).)))))))))))))))}.}}},.....((((((((.(((......))).)))),})))..,,,,.................

Transcripts

ID Sequence Length GC content
GCUUUGUGCGGCUCCAGGCCUCCGAGUGGACUCCAGAAAGCCUGAAAAG… 1240 nt 0.4242
Summary

Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the GSTA4 as a hub gene in the sky-blue module associated with cell membrane signal transduction in ST-segment elevation myocardial infarction (STEMI) patients through weighted gene co-expression network analysis of platelet RNA-seq data [Zhang et al. DOI:PMC8129354]. In a separate study in rats, the GSTA4 was found to be significantly altered in expression in liver tissue on day 1 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].