| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUUUGUGCGGCUCCAGGCCUCCGAGUGGACUCCAGAAAGCCUGAAAAG… | 1240 nt | 0.4242 |
Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis. [provided by RefSeq, Jul 2008]
A study in humans identified the GSTA4 as a hub gene in the sky-blue module associated with cell membrane signal transduction in ST-segment elevation myocardial infarction (STEMI) patients through weighted gene co-expression network analysis of platelet RNA-seq data [Zhang et al. DOI:PMC8129354]. In a separate study in rats, the GSTA4 was found to be significantly altered in expression in liver tissue on day 1 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].