Basic Information

Symbol
GSTM2
RNA class
mRNA
Alias
Glutathione S-Transferase Mu 2 GST4 Glutathione S-Transferase Mu 2 (Muscle) Glutathione S-Transferase M2 (Muscle) GST Class-Mu 2 EC 2.5.1.18 GSTM2-2 Epididymis Secretory Sperm Binding Protein S-(Hydroxyalkyl)Glutathione Lyase M2 Glutathione S-Aralkyltransferase M2 Glutathione S-Alkyltransferase M2 Glutathione S-Aryltransferase M2 Glutathione S-Transferase M1 Glutathione S-Transferase 4 GST, Muscle GTHMUS GSTM
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_000848.4
Sequence length
1166.0 nt
GC content
0.5420

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-387.30 kcal/mol
Thermodynamic ensemble
Free energy: -406.16 kcal/mol
Frequency: 0.0000
Diversity: 307.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((.((((...((.((((((.((((((.((.((((..((..((((...(((....)))...)))).))..))))...)).)))))).)))).((((((............))))))...(((((.(((((((..(((((..((((..((.(((((.(...(((((((.......))).((((...))))...........(((((..((((.(((......)))....))))..)))))....((((..((....))...))))))))..).))))).(((((........))))).((.......((((((((((........((((..(((((((((((..((..(((....(((((((((((....)))))...)))))).((((.((((........)))).)))).....(((....)))........((((.....))))....(((((.(((.....((((((((..((((((((.((...(((.(((((....)))))..)))....((((((((((((...((((.((((((.((.........(((((((.((......)).)))))))..........)).)))))).))))....)))).((.((((..(((((...))))))))).)).)))))))))).)))))).))..))).)))))....(((((..((((((.(((((((.....(((((...((((((.(((((((.((((((((((((........(((((((.....))))))).((((.(..(((((..........))))).))))))))))))))))).))))))).......................(((......)))..))))))....)))))......))))))).))).)))))))).))).)))))...)))..)).))))))))..)))..))))...........))))))))))........)).))..)))).)))))..))))..))).))))).......(((((.....))))).))))..)))).)))))))...(((((....((((((((((....(((((((......(((.....)))...)))))))))))))))))...((.(((((((....))))).)).))...)).))).......
Thermodynamic Ensemble Prediction
......(((((((.((((...((.({((((,({{{((,({.((((,,((..((((...(((.,,,}}}...)))),))..)))}...}}.|}||||.||}}.{{{{{{...|,..,,...))))},...(((((.(({((((..(((((..((((..{,.(((((.(...(((({((.......}}}.((((...)))},.,|.....,,|((((..((((.(((......)}}....))))..))))).,..((((..{{....)}...)))}))))..).))))).(((((........))))).{{.......((((((((((...,....((((..(((((((((((..,,,,(({.{,,((((((({{((,.,,|}||,.{{||||||{((((.{(((,,....,,||||.}}||,{...{{{....|||.....,,,((((.....))))....{{{{{.{|{....,||{||,,|}}|||{{|||,|{..((((((((((((((({..,(((.....((({......|))}..,))))))))))..))))))))).|,.,|}}.||}}}}}})).||||.,,..||,,......,..(((((((({,........,|.((((..(((((...))))))))).,))))))))).)).)))}},,)}..})).}))})}}}.||{{(.,(({(({,((((((,.,,,.{((((,,,{({{((.(((((((.((((((((((((........(((((((.....))))))).((((.(..(((((..........))))).}))))}}}}}}},}}}}.,}}}}}}.......................(((......))).,)))))),,,,)))),....,,))}))}}.}})))))))))).,)),))))}...))}..,,.)))))))),.}))..))))...........))))))))))....,...},.}}..)))).)))))..))))..))).))))).......(((((.....))))).,.))..)))).)))))))...{{(({....(((((((((,...,(((((((......(((.....)))...)))))))))))))))))...||,|{{{(((,,,.}}})}.)).,)...})}})}.......

Transcripts

ID Sequence Length GC content
ACAAACGCUGAGCCCCGCCCCGCUGAGGCCUGUCUGCAGAAUCCACAGC… 1166 nt 0.5420
ACAAACGCUGAGCCCCGCCCCGCUGAGGCCUGUCUGCAGAAUCCACAGC… 1443 nt 0.4796
Summary

Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the GSTM2 was significantly altered in expression in liver tissue on day 7 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. This finding was part of a comprehensive gene expression profiling analysis that identified 740 significantly altered genes, with functional classification showing that metabolism, transport, signaling, and defense/inflammation response accounted for over 70% of these changes, and the observed gene expression trends were corroborated by biochemical measurements of triglycerides and fatty acids. A study in rats demonstrated that the GSTM2 mRNA expression was significantly altered in whole brains following blast wave exposure, with no change after a 5 psi blast but showing a marked decrease at 72 hours after a 10-11 psi exposure and an up-regulation at 72 hours after a 14-15 psi exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].