| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUGGAGUUUCGCCGCCGCAGUCUUCGCCACCAUGCCGCCCUACACCGU… | 741 nt | 0.6005 |
Glutathione S-transferases ( GST s) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GST s are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GST P1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008] CIViC Summary for GSTP1 Gene
A study in the Australian sheep blowfly *Lucilia cuprina* identified a homolog of the GSTP1 within its expressed sequence tag collection, categorizing it as a detoxification enzyme associated with insecticide resistance [Lee et al. DOI:10.1186/1471-2164-12-406]. In human sepsis research, the GSTP1 GSTO1 was found to be highly expressed in patient serum and localized to macrophages, with its elevated expression validated through meta-analysis of public datasets, identifying it as a potential diagnostic biomarker [Wang et al. DOI:10.2147/IDR.S380137].