Basic Information

Symbol
GSTP1
RNA class
mRNA
Alias
Glutathione S-Transferase Pi 1 FAEES3 GSTP GST3 Glutathione S-Transferase P GST Class-Pi EC 2.5.1.18 GSTP1-1 Fatty Acid Ethyl Ester Synthase III Epididymis Secretory Protein Li 22 Deafness, X-Linked 7 HEL-S-22 DFN7 PI
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_000852.4
Sequence length
741.0 nt
GC content
0.6005

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-293.00 kcal/mol
Thermodynamic ensemble
Free energy: -305.64 kcal/mol
Frequency: 0.0000
Diversity: 175.33
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.......(((((.((((((((((((((.((.((((((...))))........(((((((..((((((((((((....)))))).))..(((......))))))).)))))))..)).))..))))))...)))))))))))))((((((((..((((...(((((((((.....(((((((((.(((..((((..((((((((..((((.....(((((((((...((((..((((.((..((((.((...(((.(((...))).)))..)).))))...)).))))...)))))))).))))).......((((((((...)))))).))...........((((((...........))))))((((((...........(((....)))))))))(((.......)))...))))...)).))))))..))))..)))(((.....)))(((.((.((((((.....)))))).)).)))(((..((((..(((((........).))))..))))..))).....))))))))).....((((((((.(((((((......((.((((((....)))))).))....((((((((((.....)))))....))))).........((((.............)))).....))))))).)))))))).....))))))))).))))..))))))))..))))))..........................
Thermodynamic Ensemble Prediction
.((((((.......(((((.(((((((((((((({(({(,,......))))|((.,((,(((((((..(((({((({{({,,,.,||}}}.}}.,|{||}....))))))).))))))),})},)}..))))))...)))))))))))))((((((((..((((...(((((((((,,,..(((((((({.,{{..{{{{..(({(((((.{((((,.,,{(((((((((,..,(((..((((.((.,((((.((...(((.{((...)}}.)))..)).))))..,)).))))...)))))))).))))}.....}}|{||{{||,..)))))),}}...........((((((...........)))))),((((,,{{.,..,,..{{{,{|{},}||||}|(((.......))),..,},}.,,||,||}}}},,)}}}}}))),||},...)))|||,{(.((((((.....)))))).)}.}},.....,{{{,,(((((,,..,,..}.}}))..))))}}}})}}}..)))))))))..,|.((((((((.(((((((.,....((.((((((....)))))).))....((((((((((.....)))))....)))))..,{...,,{,{({......}}....))),....,))))))).))))))))...,.))))))))).))))..))))))))..))))))............,{{,...,}}....

Transcripts

ID Sequence Length GC content
GCUGGAGUUUCGCCGCCGCAGUCUUCGCCACCAUGCCGCCCUACACCGU… 741 nt 0.6005
Summary

Glutathione S-transferases ( GST s) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GST s are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GST P1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008] CIViC Summary for GSTP1 Gene

Forensic Context

A study in the Australian sheep blowfly *Lucilia cuprina* identified a homolog of the GSTP1 within its expressed sequence tag collection, categorizing it as a detoxification enzyme associated with insecticide resistance [Lee et al. DOI:10.1186/1471-2164-12-406]. In human sepsis research, the GSTP1 GSTO1 was found to be highly expressed in patient serum and localized to macrophages, with its elevated expression validated through meta-analysis of public datasets, identifying it as a potential diagnostic biomarker [Wang et al. DOI:10.2147/IDR.S380137].