| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUGCUGCCCACACCGCGCUCAGCGCCUUCACUGCCAUCCCCGCUGUC… | 1108 nt | 0.5523 | |
| AACCGAAGGGGCGAGGCGGGUCCGGGGGUGGUGCGCUCCAAUUGGGUGC… | 1189 nt | 0.5576 |
The protein encoded by this gene, glutathione S-transferase (GST) theta 2 (GSTT2), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT2 and GSTT2B are nearly identical to each other, and share 55% amino acid identity with GSTT1. All three genes may play a role in human carcinogenesis. The GSTT2 gene is a pseudogene in some populations. [provided by RefSeq, Sep 2015]
A study in humans demonstrated that a differentially methylated region in proximity to the GSTT2 gene was identified in cardiac tissue when comparing sudden unexplained death and sudden unexpected death in epilepsy cases, though this finding was noted using a less stringent statistical threshold [Steffan Noe Christiansen et al. DOI:10.3390/ijms22062790]. Research in rats showed that the GSTT2 gene exhibited significantly altered expression in liver tissue on day 4 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].