| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCAGCCCUGGGCGGUCCCGGGAAUCGCACAGGACCCGGCUCCCCUCGC… | 2392 nt | 0.5686 |
This gene encodes a member of the lipoxygenase family of proteins. The encoded enzyme acts on different polyunsaturated fatty acid substrates to generate bioactive lipid mediators including eicosanoids and lipoxins. The encoded enzyme and its reaction products have been shown to regulate platelet function. Elevated expression of this gene has been observed in pancreatic islets derived from human diabetes patients. Allelic variants in this gene may be associated with susceptibility to toxoplasmosis. Multiple pseudogenes of this gene have been identified in the human genome. [provided by RefSeq, Aug 2017]
A study in porcine skin demonstrated that the ALOX12 was significantly down-regulated following chlorine vapor exposure, showing a -4.365-fold change at 1.5 hours, -7.106-fold at 3 hours, -6.634-fold at 6 hours, and -2.883-fold at 24 hours post-exposure, and was identified as a common gene in altered signaling pathways and a potential therapeutic target for existing drugs [Price et al. DOI:10.3109/15569527.2012.679374]. In human circulating leukocytes, major blunt trauma triggered a transient up-regulation of the ALOX12, with its expression pattern maintained for up to 28 days after injury [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f].