Basic Information

Symbol
ALOX12
RNA class
mRNA
Alias
Arachidonate 12-Lipoxygenase, 12S Type 12S-LOX Polyunsaturated Fatty Acid Lipoxygenase ALOX12 Arachidonate 12-Lipoxygenase, 12S-Type Arachidonate (12S)-Lipoxygenase Arachidonate (15S)-Lipoxygenase Platelet-Type Lipoxygenase 12 Lipoxin Synthase 12-LO 12S-Lipoxygenase Platelet 12-LOX LOG12 Arachidonate 15-Lipoxygenase,15S-Type Platelet-Type 12-Lipoxygenase Arachidonate 12-Lipoxygenase Linoleate (13S)-Lipoxygenase Linoleate 13S-Lipoxygenase EC 1.13.11.31 EC 1.13.11.33 EC 1.13.11.- EC 3.3.2.- EC 1.13.11 12-LOX 12LO
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000697.3
Sequence length
2392.0 nt
GC content
0.5686

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-920.40 kcal/mol
Thermodynamic ensemble
Free energy: -961.20 kcal/mol
Frequency: 0.0000
Diversity: 627.40
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((..((((((((.(.((((((((..((.((((.(((((((((((..((.......)).)))))))((((((((..((....))..)).))))))...)))).))))))..))).))))).)......((.((..((((....))))..))))..(((((((....((.(((((......))))).)).)))))))((((.(((((((.(((((((.........((.((((((....((((((((....((...((((.((((..(..(((((((((((((((((.((((((((((....(.((((((((..((((.(((((((((((....((.((((.((((((........))))))((((((((((((...(((....)))...)))))(((((((((.(((..(((((..(((.(.((((((((((((.....))))).))))).(((((.((((((((..((...((((((..(((..(((((((.((....))..(..((((....))))..)((((..(((.....)))..)))).(((..((((...((((......)))).)))).)))(((...(((((...(((..........(((((((((.((((.((.................))..)))).)))))))))......(((((((((((......)).))))))))).)))..))))))))(((((.(((....))))))))..)))))))...)))..))))))...))..))))))))..((((........))))...((((((...))))))))))))))))).)))))..))).)))))))))(((((((..(((((((((((((.((((((......))))))..)))......))))))))))...)))))))..(((((......)))))............(((((((.........((((((.(((((((((.....((((((..(((((.(((.((((.........))))))).).))))..))))))(((((.((((((((((.....((((..((((((..(((....))).((((((((.((((((((((((((((..((((.(((((((.......((((((((.......(((...(((((.....)))))....)))...(((((((.((((.((((((............)))))))))).(((((((..............)).))))).............))..)))))))))))))......)))))))))))((...(((((...))))).))...........(((..((.((...(((((((((((((...(((((((((((((((...)))).)))..)))))...))).)))))))))).))).)).))..)))((((......))))))))))))((((((((.(((......((.......)).....)))))))))))......)))))))).)))).)))).((((((................)))))).))))))..))))......)))))).......)).)).)))))......)))).)))))...))))))....((((.((((...........))))...))))(((((....)))))...)))))))....(((((((....)))))))..)))))))...))))))....))))))))..))).))))..))))...)))).).......))))))......((((((((.....((........)).....((((.((((((((....((((((.......((((........))))))))))......)))))))))))))))))))).)))))))))))))))...))))))...((((((.......(((((....)))))...)))))).........((((((........(((((((....))))))).((((((....(((..(((.((.((((..((((...)))).))))..)).)))...))).....)))))))))))).)..)))).))))...))))))))))((((((.(((.......)))..)))).)).(((((((((..(.((((((......)))....))))..))))))))))))))).))..))))))).))))))))))).................((((.....))))))))))))..)).((((.(.((((((((((((..((((......))))..)))))))))..((((((((((...((((.(((....(.(((...(((((.........)))))...))))....)))...)))).))))))))))((((.(((....)))))))...........))).)))))....
Thermodynamic Ensemble Prediction
.((..((((((((,(.((((((((..((.((((.((((((,(((({{((.......)}.)))))),|||,{{((,,((....||..,}})))))),.,)))).))))))..))).))))),){{,,..,,.{|,,|(((....)))|{{.|{|{.(({{((({.,{((,{((((.,,,..}}))).)),)))))}}((((.(((((((.(((((((.........{(.((((((...{((((((({...,((...((((.((((..{..(((((((((((((((((.(((({(({(({{({({{((((,,,..||||}|||||||{(((.,,.{(,{(((.(((({((,,.,,.,||}|||{{{{||||||{|}.||||.|,,)))|.|)}}))||{,(((((,(((..{{,(({.,(({(.{,((((((((((.....))))))))))).{{{,(,{(({{(((.....}}|.(((((({,...||||||({....(((((((({((((....)))).({((,,.{((({{...},,,{|,,|.{{,.(((,({..((((..{((((.|..({((((((((.(((((..,.........{({{.({(((((((((.((((..({....{....,||....}},.)))).)))))))}|{,.{.,(((((((((((......)).))))))))){||||..,}}.|},||(((.(((,,{{|||{,,{{{{{{|((|(.{{{..{.{||{,,..{|,{{||,,,,,,..,|||}}}}}}),,))).}})||||}.}}))))))))))).}})}),)}}||..}}}.}))),,,((((.((({,(((((,{{((,,,,.{{((((......}|||||,.,||...}}.})))))}|||{..{((((((....))))))}..,,)))}....,,{,..{((((.(.,.{((......,.))}.|,|,))))},.,,((((((..(((({.((,{((((.........))))))).,.))))..))))))||||,..,,|,|}))))))}.))))..|||||}}}}|}}}.}))).((((((((.((((((((((((((((..((((.(((((((.......((((((((...,...(((...(((((.....)))))....)))...(((((((.((((,,,,,||}...}}}}})}.}}||}}}}}}.(((((((..............)),,)))).............}}..,,.,.))))))))......))))))))))){{..,(((((...))))).)}...........(((..((.((...(((((((((((((...((,((((((((((((...)))).)))..}))))...},,.)))))))))}.))).)).))..)))((((......))))))))))))((((((((.(((......((.......)).....)))))))))))......)))))))).)))).))))...))))})))))))}.}}..})))))..)))),)).}))})}},}}}}.})))}}}...}))}},.((|{{{({.({{..,{||{,|{{.,,))),)))},..}}).))))))))....))))))))),))||(({....}))))},.,))))))....{((((({....}))))))..|||||||,,,|||}},....||||}}}}..)))}}}))},)))).}})))}......}}}))}})),....,|||{||||,....{{........)).,,,,((((.((((((((...,(({{(({,{....(({{......}}}))))))}}).}},..))))))))))})}))))))).)))))))))))))))...)))))).,.((((((.,.....(((({....}))))..})))))),}.......((((((........{((((({....})))))}.((((((....(((.{((.{{(,({((...{{{...}})..)))),....}})},.))).....)))))))))))).}..)))).))))...))))))))))|{((((.(((.......)))..)))).}}.(((((((((..(.((((((......)))....))))..))))))))))))))).)}..))))))).)))))))))))........,,,,.,,..,,||.,}}})))}))))))))..)).(({{{(.((((((((((((..((((......))))..)))))))))..((((((((((...((((.,{,,.,,,.(((...(((((.........)))))...))}.....}))...)))).))))))))))((({,(({....}))))))...........))).)))))....

Transcripts

ID Sequence Length GC content
GGCAGCCCUGGGCGGUCCCGGGAAUCGCACAGGACCCGGCUCCCCUCGC… 2392 nt 0.5686
Summary

This gene encodes a member of the lipoxygenase family of proteins. The encoded enzyme acts on different polyunsaturated fatty acid substrates to generate bioactive lipid mediators including eicosanoids and lipoxins. The encoded enzyme and its reaction products have been shown to regulate platelet function. Elevated expression of this gene has been observed in pancreatic islets derived from human diabetes patients. Allelic variants in this gene may be associated with susceptibility to toxoplasmosis. Multiple pseudogenes of this gene have been identified in the human genome. [provided by RefSeq, Aug 2017]

Forensic Context

A study in porcine skin demonstrated that the ALOX12 was significantly down-regulated following chlorine vapor exposure, showing a -4.365-fold change at 1.5 hours, -7.106-fold at 3 hours, -6.634-fold at 6 hours, and -2.883-fold at 24 hours post-exposure, and was identified as a common gene in altered signaling pathways and a potential therapeutic target for existing drugs [Price et al. DOI:10.3109/15569527.2012.679374]. In human circulating leukocytes, major blunt trauma triggered a transient up-regulation of the ALOX12, with its expression pattern maintained for up to 28 days after injury [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f].