Basic Information

Symbol
GYPA
RNA class
mRNA
Alias
Glycophorin A (MNS Blood Group) PAS-2 GPA Sialoglycoprotein Alpha MN Sialoglycoprotein CD235a MNS MN Glycophorin A (MN Blood Group) Glycophorin-A Erythroid-Lineage-Specific Membrane Sialoglycoprotein Recombinant Glycophorin A-B Miltenberger-DR Glycophorin A (Includes MN Blood Group) Mi.V Glycoprotein (24 AA) Glycophorin A Transcript Glycophorin Sta Type C Glycophorin A, GPA Glycophorin Erik Glycophorin MiI Glycophorin MiV Glycophorin SAT CD235a Antigen GlycophorinA HGpSta(C) HGpMiXI GPErik HGpMiV GPSAT
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_002099.8
Sequence length
2627.0 nt
GC content
0.3384

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-559.90 kcal/mol
Thermodynamic ensemble
Free energy: -614.32 kcal/mol
Frequency: 0.0000
Diversity: 797.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((....((((((((((((.(....)))).))))).((((.((......))))))(((((.((((((.(((((((((.((..((((.((((.((.((((...)))).)).)))))))).)).))))))))).((((((((..((((.((..(((((((((...)).)))))))....((((((.((((.....(((......)))((((........)))).((((((((((((((...((((.((((.......).))))))).(((((((((....))))...)))))......((((.....))))....(((((((((((((.....)))))....))))))))..((((((((((......))))))))))(((((.((..(((..(((((((.......((((....((...((((....))))...))..))))........)))))))....)))....)).)))))...(((....))).......))))))))((((((((..((((((.((..((((((...(((((((((((((((.........((((.......)))).......(((..(((....)))..)))............))))))((((...)))).((((.(((.(((((((..((((((((...........)))))))).((((((..((((((.....))))))))))))(((((.(((((((..(((((((..(((((((((.....((((((((((.....(((((....(((...((.......((.((((((((((....)))))))))).)).......))...)))...)))))...)))))))))).............(((.(((..(((....................)))..)))))))))))))))....)))).)))..))))))).))))).((((....(((.((((..((((((..((((....(((((..((((((((......)))).....(((.((((((((.(((((.....)))))(((((..((((((((((((((((.((........((((........(((((.....((((...((((..(((((.................................(((((((((...(((((.........)))))...)))))).)))((((((..(((........)))..))))))...........((((....))))..)))))..).)))....))))))))).........)))))))))))))))))).))))..)))))....)))))))).))).......))))..)))))))))))))))..)))).)))....)))).((((.(.....).))))))))))).))).))))((((....)))).)))))))))((((((...))))))..(((((((((.(((((((..((((..........((((((((.(((((((...)))))))..)))))))))))).)))))))..)))))).))).........))))))..(((((...............))))).....................))))).)))..)))))))).....(((((((((((.....)).))))))))).))))))..............(((((((((((((..((...((((..((((((.(((((((..((((((.((((.((..........................)).)))).)))).))))))))))))))).)))).))..)))))))))))))..)))))))))))).)).))..))))))))..((((((((((((((((.((((((((((((....(((((.(((((...))))))))))..)))))........))))))).))))..)))))..)))))))...((((((((...((((((((.......))))))))(((((.(..(((((...((..(((((((((((((.(((((((...(((((.............((((.......))))...........)))))....))))))).)))((((........))))....))).)))).)))..))...)))))..))))))........(((((...((((((....(..(((((((((.........(((((((........)))))))))))).))))..)..(((((.(((..((((.(((((.(((((((((((((((.......(((((....)))))((((...........))))))))))..((....))...)))))....(((((((..((........))..))))))).))))..).)))).))))((.(((((((..((((...(((((((.........)))))))..))))..)).))))).)))))..)))))...))))))...)))))......))))))))..)))))).)))))((...((((((.(((.(((((...))))).)))..))))))...))..(((((((..........))))))).(((((((((((.........((((....))))...((((....))))..)))))))))))...)))))).
Thermodynamic Ensemble Prediction
..({.{{((((((,,,|||}}.}}})),|{{|||{{(((({(({{{...{{{..{(,(((.(((((,.{{((((((,{(({{((((,((({....,,,....,|{|{{|{,,,|{|||.,,.,||||||||.,,,,{||,..{{({.....(((((((((...)).))))))).,,.,,,,,,.,{||,,,..(((......))).||||,}}|||.}}}}}}|.......,,,.....||||}|,,,..}}}}.)}).)))))},|||||,||}.}},,))}.}))))){{{,..((((.....)))),}}}(((((((((((((.....)))))....)))))))).}|||||||||}}......,,,,,,|||(((,((((.{(.,.((((.((({.({{..((((..,,,.,{{(((({{,.||,|,.{||{.,|||,,.,,...|||{{{{,......{{{.{{{{{{{{,{.,,|}}..|||{{{{,{{{{{{(((,,,,||||||,.,.{{{{{{|,.,{{.....(((((((((((((,(,........{{||,...,,,)}},..((((.,....,.)))),{{{..{{{.........}}},,})))|(({...))),.((((.(((.(((((((..,{((((((,,......,,,||||}}}|,((((((..((((({.....}))))}})))))(((((.(((((((..(((((((..(((((((((,,,..((((((((((.....(((((,{,.(({.,,{{,.{{,||}|.{{{{{(((((,,,.}}}})})))))))),.,,,.},...)))...)))))...))))))))))..,,,........(((.(((.,(({.,,,{,,,|,,|,},...},)}}..)))))))))))))))....))))},))..))))))).))))).|||{....,{,,((((.,((((((..{(((.,,.({{{{..{{{(((((......)))),....(((.((((((((.(((((.....))))}(((({..{{{{{{{{{{{||||{.,,...,{|{{{{......}}}}}|((....|||{{{...{{{,..,,,,,................................{(((((((((...(((((.........)))))...)))))).)))},{(((..{{{........)))..}}}}},.........,|{{{,.,,,|}},,,)))}}.,|{}}},,..,}}},)}}}}}}|}...,|}},}|)))}}}}}))))}}}}},,))})),,..)))))))}.)}}.......})))..))))}})))))))))..)))).,,,....}}}}.{|||,|,,...).}}}}))))))).))).))))((((....)))).))))))))){{{{{,.,,|}}},}.,(((((((((.(((((((..{{,,........{{((((((((.(((((({...})))))).,)))))))))))).)))))))..)))))).)))....,,,|||||||||||||||{{,....,,......||,,,................,..,,,,}}||}||{{{{{,{({(((({{(((((((((((.....)).))))))))).|{{,{||.,,..,,||{,,.{{,,,|||||}|}}...,,.||},)}}|((({{,{{{{{{|||||((({{,....||||||.......,}}}},,.......,...)))}))))||}}}}}}}}},||||.||||.,,.,}}),))))}}}}}},}}}}}}}}})),.,},}}||||||}}}|{{((((((((((((((({.{(((((((((({....((((,{(((((...))))))))))..)))))........))))))).)))).,})}}},.,})}},},,,|||{,,||,..{{((((((.......)))))))){{{,{{{..{{{||...||..{{|||||{{|{{{.{{{{{{{|,.{{{({,{{|{,,...|},{{{{.,,,.,|||||.....,||||||||}}...}))))))).}}}((((........))))....})),)))).}))..}}...}}}}}.,})}}}}.....,,,(({({...{{{|||,...(..(((((((((.........(((((((........))))))))))))}})))..),.(((((.(((..((((.(((((.((({(((((((((((,......(((((....)))))((((.{.........)))))))))),.((....))...,))))....(((((((..((........))..))))))).))))..)}}})).))))({.((((({(,.{{{{...{((((((.,,...,,.))))))}..}}}).})).))))).)))))..))))}...)))))}...})))}......}}}})}}}..))))}},)))))||,..{(((((.(((.(((({...})))).)))..})))))...,,}}|||||{||}......,,))}},,|,{{{|||||||,,.,,..}}.||,.,,}}))))}}.,}}|}.}}).)))}.)))),,,)))))),))))),

Transcripts

ID Sequence Length GC content
AGGCUAAGGUCAGACACUGACACUUGCAGUUGUCUUUGGUAGUUUUUUU… 2588 nt 0.3366
AGGCUAAGGUCAGACACUGACACUUGCAGUUGUCUUUGGUAGUUUUUUU… 2528 nt 0.3362
AGGCUAAGGUCAGACACUGACACUUGCAGUUGUCUUUGGUAGUUUUUUU… 2627 nt 0.3384
Summary

Glycophorins A (GYPA) and B (GYPB) are major sialoglycoproteins of the human erythrocyte membrane which bear the antigenic determinants for the MN and Ss blood groups. In addition to the M or N and S or s antigens that commonly occur in all populations, about 40 related variant phenotypes have been identified. These variants include all the variants of the Miltenberger complex and several isoforms of Sta, as well as Dantu, Sat, He, Mg, and deletion variants Ena, S-s-U- and Mk. Most of the variants are the result of gene recombinations between GYPA and GYPB. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human and animal samples demonstrated that the GYPA mRNA, an erythrocytic marker, is useful for human blood identification and determining species specificity, as it was specifically detected in human blood and some primate blood but not in non-primates [Matsumura et al. DOI:10.1111/1556-4029.13045]. A separate investigation on aged human bloodstains stored for 30 to 50 years found that the GYPA marker provided detectable signals, though these were not as strong as those from hemoglobin subunits, confirming its utility in mRNA profiling for aged sample identification [Zhao et al. DOI:10.1016/j.forsciint.2017.01.006]. A study in humans demonstrated that the GYPA mRNA is a reliable marker for blood identification and can be successfully co-extracted with DNA from forensic samples using a modified Promega DNA IQ™ system, enabling simultaneous genetic profiling and body fluid identification from the same stain [Bowden et al. DOI:10.1016/J.Fsigen.2009.11.007]. Research on enhanced bloodstained fingermarks showed that the GYPA mRNA can be detected after chemical treatments, though its recovery is adversely affected by leucocrystal violet, and to a lesser extent by aqueous amido black and acid yellow, especially in depleted samples with low cellular material [Fox et al. DOI:10.1016/j.scijus.2014.01.001].