| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUUGUCUUUGGUAGUUUUUUUGCACUAACUUCAGGAACCAGCUCAU… | 609 nt | 0.4220 | |
| AACAGCUAGUAGGCUAAGGCCAGACACUGACACUUGCAGUUGUCUUUGG… | 564 nt | 0.4184 |
Glycophorins A (GYPA) and B (GYPB) are major sialoglycoproteins of the human erythrocyte membrane which bear the antigenic determinants for the MN and Ss blood groups. GYPB gene consists of 5 exons and has 97% sequence homology with GYPA from the 5' UTR to the coding sequence encoding the first 45 amino acids. In addition to the M or N and S or s antigens, that commonly occur in all populations, about 40 related variant phenotypes have been identified. These variants include all the variants of the Miltenberger complex and several isoforms of Sta; also, Dantu, Sat, He, Mg, and deletion variants Ena, S-s-U- and Mk. Most of the variants are the result of gene recombinations between GYPA and GYPB. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
A study in humans demonstrated that the GYPB mRNA is a specific marker for venous blood identification, exhibiting low expression in the target body fluid but no detectable reads in other tested body fluids [Yu et al. DOI:10.1016/j.fsigen.2025.103416]. A study in human bloodstained fingermarks demonstrated that the GYPB mRNA marker for blood identification can be successfully detected after chemical enhancement, though detection efficacy varies by method, with leucocrystal violet preventing detection in the most depleted samples and aqueous amido black and acid yellow also showing adverse effects on depleted marks [Fox et al. DOI:10.1016/j.scijus.2014.01.001]. A co-extraction method for human forensic samples confirmed the GYPB is reliably detected in blood samples and casework bloodstains, enabling body fluid identification alongside DNA profiling from the same sample [Bowden et al. DOI:10.1016/J.Fsigen.2009.11.007].