| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAUUUUCAGGUUGAUUGAUGUGGGACAGCAGCCACAAUGAGGAACUCC… | 896 nt | 0.4275 |
Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008]
A study in humans identified the GZMA as a potential diagnostic biomarker for sepsis, where its expression was significantly higher in healthy control groups compared to sepsis patients across multiple datasets [Li et al. DOI:10.3389/fimmu.2024.1445858].