| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUCCAACCAGGGCAGCCUUCCUGAGAAGAUGCAACCAAUCCUGCUUC… | 904 nt | 0.5288 | |
| AGCUCCAACCAGGGCAGCCUUCCUGAGAAGAUGCAACCAAUCCUGCUUC… | 891 nt | 0.5309 |
This gene encodes a member of the granzyme subfamily of proteins, part of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs) and proteolytically processed to generate the active protease, which induces target cell apoptosis. This protein also processes cytokines and degrades extracellular matrix proteins, and these roles are implicated in chronic inflammation and wound healing. Expression of this gene may be elevated in human patients with cardiac fibrosis. [provided by RefSeq, Sep 2016]
A study in humans demonstrated that the GZMB is a lysosome-related gene whose expression in peripheral blood is significantly higher in normal controls compared to sepsis patients, with high expression correlating with a higher 28-day survival rate in sepsis patients [Chen et al. DOI:10.1186/s12865-023-00588-7]. In a separate review of mouse and human studies, the GZMB was identified as an effector molecule from CD8+ T-cells that promotes apoptosis and endothelial cell shedding, leading to plaque erosion [Bian et al. DOI:10.3892/mmr.2025.13680].