Basic Information

Symbol
GZMK
RNA class
mRNA
Alias
Granzyme K TRYP2 Fragmentin-3 Granzyme K (Serine Protease, Granzyme 3; Tryptase II) Granzyme K (Granzyme 3; Tryptase II) NK-Tryptase-2 Tryptase II Granzyme-3 NK-Tryp-2 PRSS EC 3.4.21.- EC 3.4.21.4 Granzyme 3 EC 3.4.21
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_002104.3
Sequence length
1506.0 nt
GC content
0.4050

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-381.90 kcal/mol
Thermodynamic ensemble
Free energy: -413.47 kcal/mol
Frequency: 0.0000
Diversity: 317.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((.......)))).............(((((..(((((..................((((........((((.(((((((((..(((((.....((((((((.((((((...)))))).))))))))..)))))....))))))))).)))).))))....(((((((((.((((((((((((((...(.(((((((........(((((((((((((((((((.....((((((((((.((((...((((....)))).......((....))......))))..))))))))))..))))).))...(((..(((...)))..)))))))))..))))))....((((..................))))..(((((..(((((.......(((....)))......)))))..)))))....((((((((...((..(((....)))..)).)))((((..(((((...........)))))....))))(((........)))....)))))(((((.((((....(((((.((....(.(((((((((((((((((.((((((.((((((((......)))....((((((((....).))))))).....))))).)))(((((..............((((((..(((.....)))...))))))))))).))).))).))))))..)))))))))....)))))))....)))).))))).))))))).)...))))))))))))))(((((...)))))...)))))))))................)))))...)))))...(((....((((((...(((((...........(((.((((((....)))))).))))))))...))))))......)))..(((.(((.((..(((.(((((((((((..(((((((((((.....(((((((.....(((((....)))))......(((((..((..(((((........)))))..))..)))))......((((((((((.((((((((...........((((((((.........)))))))).................(((((.....((..........))....)))))...((....)))))))))))))).)))))).(((((......)))))......((((.(((((((((((.(((((.(((((..((((..((((.(((((...))))).))))...))))..)))))..)))))......((((.((((........)))).))))...)))).))))))).)))).((((.((....)).))))......((((....)))).......((((((..((((((.......))))................))..)))))))))))))....))))..)))).(((((.(((((((((...))))))))))))))..)))..))).)))))))).)))..))))).))).....
Thermodynamic Ensemble Prediction
.{{....,..((((.......))))...,......|,.(((((..(((((..................,||,...|,,,,((((.{(((({(({..(((((..,,,{(((((((.((((((...)))))).)))))))),.)))))....})))))))),)))).|},.....(((((((((.{(((((((((((((...{.(((((((.....,..{(((({(((((((({((((..,,.((((((((((.((((...(({(....}}}|,......|{|...,,...})}))))..)))))))))).,))))).}},,.|{{..(((...}}}.,)))}}))|}|.,}}}}}..|,|||{..................)))}..|{|{{..{{{{({..,|..{{{..,|)},..,.,.|))))..))),}....(((((({{...{{..,,,....|}}..}}.))),{{,..,.(((((.,,........)).)))))|}|(((........)))}.,,)))))(((((.((((....(((({{((....(.(((((((((((((((((.(({(((.(((({,{({,....|||....((((((((....),})))))),,...))))).)))(((((..............{(((((..(((.....))),..))))))))))).))).))),})))))..)))))))),....)))))))....)))).))))).))))))).}...)))))))))))))|(((((...)))))...)))))))))..,,,....,......})))}...))))}...(((..{,((((((...{((((...........(((.((((({....)))))).))}))))}...))))))..,,..)))..{((.(((.((..(((.(((((((((((..,,,((((((((.....(((((((,,,..{(((({{,.|||||.,....{{{,{{{((..(((((........)))))..)}.,}||}}......((((((((({{((((((((...........((((((((.........))))))))......,..,,......(((((...{,((..........)}.,..)))))...,|....}})))))))))))),}))))).(((((......)))))......{(((.(((((((((({.(((((.(((((..((((..((((.(((({...})))).)))).,.))))..)))))..)))))....{,{(((.((((........)))).)))),..)))).))))))).))))}||||,,,...{||.||||{(((.{(..{{{{{|,,,...,}}}||,,||.}||,.|}}}}.,,},,,.....................,))),,)))))))....))))..)))).(((((.(((((((({...})))))))))))))..,,,..})),))}))))).)))..))))).))).....

Transcripts

ID Sequence Length GC content
AGAAUCUUCUUCCUUCAUCACAGGAUCAACACAUUUCAUCUGGGCUUCU… 1506 nt 0.4050
Summary

This gene product is a member of a group of related serine proteases from the cytoplasmic granules of cytotoxic lymphocytes. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here lacks consensus sequences for N-glycosylation present in other granzymes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the GZMK is highly expressed in the T10 T cell subpopulation within peripheral blood mononuclear cells from an irradiated patient, as identified via single-cell RNA sequencing [Yan et al. DOI:10.3892/etm.2025.12846]. A review of mouse and human studies following myocardial infarction identified the GZMK as a characteristic marker for effector T-cells, specifically the CD8-C2-Gzmk effector T-cell cluster [Bian et al. DOI:10.3892/mmr.2025.13680].