| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAUCUUCUUCCUUCAUCACAGGAUCAACACAUUUCAUCUGGGCUUCU… | 1506 nt | 0.4050 |
This gene product is a member of a group of related serine proteases from the cytoplasmic granules of cytotoxic lymphocytes. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here lacks consensus sequences for N-glycosylation present in other granzymes. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the GZMK is highly expressed in the T10 T cell subpopulation within peripheral blood mononuclear cells from an irradiated patient, as identified via single-cell RNA sequencing [Yan et al. DOI:10.3892/etm.2025.12846]. A review of mouse and human studies following myocardial infarction identified the GZMK as a characteristic marker for effector T-cells, specifically the CD8-C2-Gzmk effector T-cell cluster [Bian et al. DOI:10.3892/mmr.2025.13680].