Basic Information

Symbol
H1-0
RNA class
mRNA
Alias
H1.0 Linker Histone H1.0 H1F0 H1FV H1 Histone Family Member 0 H1.0, H1(0), H1-0 Histone H1(0) Histone H1.0 Histone H1' H1 Histone Family, Member 0 H10
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_005318.4
Sequence length
2204.0 nt
GC content
0.5204

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-782.00 kcal/mol
Thermodynamic ensemble
Free energy: -818.90 kcal/mol
Frequency: 0.0000
Diversity: 661.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(.(((..((((((....((((((..(((.((((((.(..(((...(((((.(((((..(((((..(((.(((..((........))....)))))).)))))..)))))(((((((((.(((((.(((((((((((((..(((.(((((((.(((...(((((((....))))).)).))))).((((.....))))...))))).)))..))).))).....)))))...))))))).).))))))))...)))))((.....((.(((((.(((((..(((..........)))...)))))..))))))).....))....)))..).)))))))))..((((..((....)).))))...))))))......))).))).((((((((((((...((((((....(((((((((.((..(((((.((((.(((.((..((((((.(((.((.(((.....................(((((....)))))(((((........))))).(((......)))......((....((.((((...)))).))....)).)))....)).))))))))).)).))).))))))))).((((...((..(........)..))...))))((((...........))))........)).)))))))))((((...((((.((((...(((((...((((((.(((...((((((...................((((((((..((((((((((((((((((((.......((((......(((...........(((((.(........).)))))..(((......)))......)))..........................(((.(((((.((((((((.((((((((...(((......)))))))))))))).....))))).)).....(((((.....))))).((((((((((((((((.......(((((.(((((((((((((((((((((.((((((.((((...)))).)))))).((((((.(((..........))).))))))....(((((((((.(((((((.......)).)))))..(((....))).(((((((....))))))).............((.......))))))))))).....))))))))).(((((.((((.((.(((((((((((.....)))))))..)))).)).)))).)))))((.(((......))).))...(.(((((((((.((...(((.(((((.((.......)).))))).)))...)).))))))))).)(((((.((...(((.(((.....))).)))...)).)))))....)))))))))).)))))))(((....)))...))))))))))))))))....((((((.(((.((.....))...))).)))))).))).)))))))......))))))).)))))..............)).))))))))))((((((......)))))).))))..)))))).........((((((.((((((((((....)))))))))).)))))).))).)))))).))))))))))))).))))...........(((((((...((.((((.(((...(((((((((((((..(((((((((((((((.(..(((......)))..)..)))).)))).((((((((((((....))))))))....))))))))))))))))))))))))......))))))).))))))))))))))).)))))))...)))))(((((((((.(((((.........((.(((.....)))))........))))).)))))))))..(((((((((.(((((.(.(((((.((((((....((((((((.(((((((((.......)).))))..)))))))))))((((..((((...(((((((((((((((......))))))))))..(((((.......)))))((((...(((((...))))).))))......)))))...))))..))))((((((....))))))...........))).))).)))))).))))).)))))))))....((((((...)))))).))).)....((((.((.(((.....(((((((....))))))).....)))..)).))))..
Thermodynamic Ensemble Prediction
...{.,((..,((((.....((((((,,(((,((((((.(,.({({{.{,(((.(((((..(((((..({(((((..({........)}....)))))).)))))..)))))(((((((((.(((((.((((((((({(({..(((.(((((((.(((...(((((((....))))).)).))))).((((.....))))...}}}}).))),.))).))),.,..))))},,.))))))).).))))))))...|||||,|..|,|((,{{(((.{((((..(((..........)))...))))}..))))},,.,,.,},....,})..).))})))})),,((((..(({{..,,))))...}))),,,..,..({(,.,,}||..,,,{{.,,..,{(.,,.}},..(((((((((.((..(((((.((((.(((.((..((({(({(((.((.{{{......,,......,,...,.(((((....)))))(((({..,..,,,}}}}}.{,,...,|||},...,..{{,...((.((((...)))).))....)}.}}}....)).))))))))).)).))).))))))))).(((,...{{{,(........|..)),..||||((((..,....,|..}}})}.......}}.)))))))))(((......|||......||{......))))))))}}....,}}}}.},......,{{...,{{,.{{{{({{..{{{||||{((((((((,((({({{...((((......,,,...........(((((.(........}.)))))..(((......))}......}||{,,,{{{{{{,.......,{{{,,{{((({{{,((,,((((((,(((((((((...(((......))))))))))))||{.,,.}},}}.})}.},,(((({.....}}}}}.{(((((((((((((((,......(((((.(((((((((((((((((((((.((((((.((({...}))).)))))}.((((((.(((.,......,.))).))))))....(((((((((.((((((,...,..{||{{}|||.,{{,..,.}||{((,,{,,.,,,))))))}}},,}}},.....||,....,,}}))))))))).....))))))))).(((((.((((.((.(((((((((((.....)))))))..}))).)).)))).)))))|(.(((......))).)}...{.(((((((((.((...(((.(((((.{{.......)}.))))).)))...)).))))))))).}(((((.((...(((.(((,...,))).)))...)).)))))....)))))))))).)))))))(((....)))..,))))))))))))))),....{({(((.{((,((,,,,,||,{,|||,}||}}}.,)).))))}}|.....|||},|||||||||{.||}}||,,,|||,|||||}},})||{(((((......}})))}}))))},))))|||,...,,,,||{|||,||||{(((((,,,,|}}|||||||,|}}|||,}}}.}))))}))))))))}..,)))))))))),{{{{...{{{||||,...{.(((({{,,,|}|||{|||||{|||}}|||||||||||{{||,,..{{{.,.,,,))},,)..}}}}.|}}}.{{{{((((((((....))))))))...,||||||}},,.}))))))))))))}}}}}}})||||,...,,,})))),}},))))))))))))))),)||||||})))|||,..........|..|||}}}}}),),)}}}}.......{{{{|..,.)))}){((((((((.(((((.(.(((((.((((((,...((((((({,(((((((((.......))})}))..)))))))))))((((..((((...(((((((((((((((......}})))))))),.{{(((.......}}}}|((((...(((({...))))).}}},.....})))))...))))..))))((((((....))))))},....,,.,.))),})).)))))},))))).))))))))}....((((((...))))))})))))....,|||,{{.{{{,,.|,(((((({....}))))}}....})},..,)}}},...

Transcripts

ID Sequence Length GC content
AGACGCGGAGCUGGGAAAAGGGAGGCAGAGGAGGCGGAGGCAGAGGCAG… 2204 nt 0.5204
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-independent histone that is a member of the histone H1 family. [provided by RefSeq, Oct 2015]

Forensic Context

A study in humans demonstrated that the H1-0 gene was downregulated as part of the inhibited programmed cell death pathway in the lungs of patients who succumbed to septic shock, as identified through RNA sequencing of post-mortem tissue samples [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].