Basic Information

Symbol
H2AC12
RNA class
mRNA
Alias
H2A Clustered Histone 12 DJ86C11.1 HIST1H2AH H2AFALii H2A/S Histone Cluster 1 H2A Family Member H Histone Cluster 1, H2ah Histone H2A Type 1-H Histone H2A/S H2A Histone Family Member H2A-Clustered Histone 12 Histone 1, H2ah HIST1H2AI H2AH
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_080596.3
Sequence length
457.0 nt
GC content
0.5908

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-177.80 kcal/mol
Thermodynamic ensemble
Free energy: -185.98 kcal/mol
Frequency: 0.0000
Diversity: 139.49
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((..((((((.((((.....))))..((((..((((.((((((...(((((.(((.(((((.((.((((.......)))))).)))))((........))))))))))..))))))))))))))...((((....))))..((.((((((((..((((((((((.....))))).(((((.(.((....)).))))))........((..((.(((((......))))).))..))....((.((......)).))..)))))..)))))))).))....))))))....((.((((.....)))).))((((((.(.(((((((......))))))).)))))))....((..((((.((((.((((((......................))))......)).)))).))))..))..)))))))......((((((....)))))).
Thermodynamic Ensemble Prediction
.,(((((((..,((({{.{((({,,{{|||(,.((((,.{((,,((((((...(((((.{((,,({{(,{(.((((,,,....}))))}|)})}|{,,.......||)}})))))..)))))))))}||}}...((({....}))){.((.((((((((..((((((((((.....))))).{{(({,|,||....)).)}))))........((..((.(((((......))))).))..))....,,.{{...,..,,....,)))))..)))))))).)),.,.||},.,...,{(.((((.....)))).)|((((({{(.(((((((......))))))).)))))))....|}}}}|||}|}}|}||||||,,....}))))}}),,.......|||,....,||||||}.}}||,|,...}}}}},,.,,,..{|||||,,..})}))).

Transcripts

ID Sequence Length GC content
ACUUUCAGUAAGUUGUGACCAGUAUGUCUGGACGUGGCAAGCAAGGCGG… 457 nt 0.5908
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Aug 2015]

Forensic Context

A study in human bone demonstrated that the H2AC12 was drastically reduced in bone tissue after decomposition and was selected as one of five proteins in a final integrated multi-omics model for postmortem interval estimation [Bonicelli et al. DOI:10.7554/eLife.83658].