Basic Information

Symbol
H2AC16
RNA class
mRNA
Alias
H2A Clustered Histone 16 DJ193B12.9 HIST1H2AL H2A/I H2AFI Histone Cluster 1 H2A Family Member L H2A Histone Family, Member I Histone Cluster 1, H2al Histone H2A Type 1 Histone 1, H2al Histone H2A/Ptl H2A.1 HIST1H2AG HIST1H2AI HIST1H2AK HIST1H2AM H2AC11 H2AC13 H2AC15 H2AC17 H2A.I H2AFP H2AFC H2AFD H2AFN
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003511.3
Sequence length
482.0 nt
GC content
0.6037

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-176.40 kcal/mol
Thermodynamic ensemble
Free energy: -183.92 kcal/mol
Frequency: 0.0000
Diversity: 130.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((...((((((((......((((((((((....(((((((.(..(((..((.(.(((......))).)))....)))..).)))((((((((((.((.((((((((((...((((..((((.(((((((((((((((.(((.((....)).))).)))).))))((.((....)).))))))))).)))).)))).))))))).))).....)))))))....)))))..((((((......))))))))))....)))))...((........))((((........)))).......))))).)))))))).))).))))).((((((..(..((((((......))))))..).))))))......(((.((.(((.(((....(((((((((.(((.((.......(((...)))......)).)))....(((.....)))........))).))))))))))))))))).
Thermodynamic Ensemble Prediction
((((((((...((((((((......{(({,(((((....(((((((.{,{(((..((.(.(((......))).)}}....|||..|.||}((((((((((.((,((((((((((.,,((({,,((((.((((,((((((((((.(((.((....)).))).))))))}))||.||}}},,),||||}}}}}}))))})})).))))))).))).}...)))))))....))))).,|{{|||...,,,))))})))))....)))))...((........))((((,,...,}.)))).....,.,}})}.)))))))).))),})))).((((((..{..((((((......))))))..}.))))))......,(({{(.{{,.{{|},..,{,,{,{,(,((({,,......|({,..{|||{.....))}))),...,,,..,,,))).........||{|||,..,)))))),}},.

Transcripts

ID Sequence Length GC content
CGGCUGUUCUCAGUUCCUCCAUUUAUCGUUUCUUCGUCAUGUCGGGACG… 482 nt 0.6037
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]

Forensic Context

A study in human neuroblastoma (SH-SY5Y) cells demonstrated that manganese exposure induced a 2.80-fold upregulation of the H2AC16 as part of a neuroprotective cellular adaptation involving histone upregulation to mitigate DNA and chromatin damage [Cahill et al. DOI:10.3390/Biom14060647].