Basic Information

Symbol
H2AC18
RNA class
mRNA
Alias
H2A Clustered Histone 18 HIST2H2AA3 HIST2H2AA H2A.2 H2A/Q H2AFO Histone Cluster 2 H2A Family Member A3 H2A Histone Family, Member O Histone Cluster 2, H2aa3 H2A-Clustered Histone 19 Histone H2A Type 2-A Histone 2, H2aa3 H2A-Clustered Histone 18 Histone 2, H2aa Histone H2A.2 Histone H2A/O HIST2H2AA4 H2a-615 H2AC19 H2A/O H2A
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_003516.3
Sequence length
533.0 nt
GC content
0.6341

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-219.80 kcal/mol
Thermodynamic ensemble
Free energy: -228.22 kcal/mol
Frequency: 0.0000
Diversity: 81.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.....(((((.(((((.....((((((((.........(((((((((......)))))).)))..(((.((.(((.((((((((((((...(.((((((.((((((((((.((((((........).))))).)))))..((((((((.(((..((....))..))).))))))))))))).)))))).).))))...)))).)))).)))...)).)))...)))))))))))))...)))))(((((..((((((.(((........(((((((........(((((((.......((.((....))))...)))))))..........(((.((((((............))))))))).)))))))........))).))))))..)))))...........))))))))..((((.((....((((...((.(((((......(((((....))))))))))))))))((.(((...))).)).)))))).........((((((....)))))).....
Thermodynamic Ensemble Prediction
((((((((.,.,((((((.(((((.....((((((((....,,...(((((((((......)))))),,))..{{{,{(.(((.((((((((((((...(.((((((.((((((((((.((((({........).))))).)))))..((((((((.(((..((....))..))).))))))))))))).)))))),}.))))...)))).)))).)))...}}.}}}...)))))))))))))...)))))(((((..((((((.{((,.......(((((((.,.{{{..(((((((.......((.((....)}))...)))))))...}}}....(((.((((((............))))))))).)))))))........))).))))))..)))))........},,))))))))..({{,,((....((((...{(.(((((.....,|||||..,,|||||,,}},,)))))}}{({({..,|},)}.)))})).........((((((....)))))).....

Transcripts

ID Sequence Length GC content
GACUUUCCCGAUCGCCAGGCAGGAGUUUCUCUCGGUGACUACUAUCGCU… 533 nt 0.6341
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Aug 2015]

Forensic Context

A study in humans identified a molecular signature of chronic cocaine abuse in postmortem midbrain dopamine neurons, with the H2AC18 HIST2H2AA3 transcript being significantly upregulated 1.6-fold in cocaine abusers compared to controls and performing as a diagnostic biomarker capable of accurately assigning subject cohorts [Bannon et al. DOI:10.1038/Npp.2014.70].