| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACUUUCCCGAUCGCCAGGCAGGAGUUUCUCUCGGUGACUACUAUCGCU… | 533 nt | 0.6341 |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Aug 2015]
A study in humans identified a molecular signature of chronic cocaine abuse in postmortem midbrain dopamine neurons, with the H2AC18 HIST2H2AA3 transcript being significantly upregulated 1.6-fold in cocaine abusers compared to controls and performing as a diagnostic biomarker capable of accurately assigning subject cohorts [Bannon et al. DOI:10.1038/Npp.2014.70].