Basic Information

Symbol
H2AC20
RNA class
mRNA
Alias
H2A Clustered Histone 20 HIST2H2AC H2A/Q H2AFQ Histone Cluster 2 H2A Family Member C H2A Histone Family, Member Q Histone Cluster 2, H2ac Histone H2A Type 2-C Histone H2A-GL101 Histone 2, H2ac Histone H2A/Q H2A H2A-Clustered Histone 20 Histone IIa H2A-GL101
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003517.3
Sequence length
494.0 nt
GC content
0.5830

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-187.90 kcal/mol
Thermodynamic ensemble
Free energy: -195.42 kcal/mol
Frequency: 0.0000
Diversity: 59.31
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..................((((.((....(((((((((((((.(((((.(((..((((((......))))))))))))))((((((((((((((((..((((.....((((((((((.(((((((...))))).....)).)))))))))).(((((((((.(((..((....))..))).))))))))).)))))))))((.(((((.(.((.((((((((...........))))))))...(((((.(((((.((.....))))))))))))...)).).))))).))......(((((((.......((.((....))))...)))))))..........(((.((((((............))))))))))).)))))))))........(((..(((.(((.........))).))).))).....((.....))...)))))))))))))......)).))))...((((((....)))))).....
Thermodynamic Ensemble Prediction
...........,......((({.({.,.,(((((((((((((.(((((.(({..((((((......))))))})))))))((((((((((((((((..((((.....((((((((((,(,(((((...)))))...}})}.)))))))))).(((((((((.(((..((....))..))).))))))))).)))))))))((.(((((.{.{{.((((((((...........)))))))).,.((((,{((((,{((.....)))))))))))),..}}.).))))).)).{{{..(((((((.......((.((....)}))...)))))))...}}}....(((.((((((............))))))))))).)))))))))........(((,.(((,{{,.....,},,,}},)},.))).....((.....))...))))))))))))),}....}),))))...((((((....)))))).....

Transcripts

ID Sequence Length GC content
AAUCUUAUUUUGUUGCGAGGUUCUGAGCGUUGUCUGUGUUUAACCUUGA… 494 nt 0.5830
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]

Forensic Context

A study in human neuroblastoma (SH-SY5Y) cells demonstrated that manganese exposure induced a 3.36-fold upregulation of the H2AC20 as part of a neuroprotective histone upregulation response to mitigate DNA and chromatin damage [Cahill et al. DOI:10.3390/Biom14060647].