| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUCUUAUUUUGUUGCGAGGUUCUGAGCGUUGUCUGUGUUUAACCUUGA… | 494 nt | 0.5830 |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]
A study in human neuroblastoma (SH-SY5Y) cells demonstrated that manganese exposure induced a 3.36-fold upregulation of the H2AC20 as part of a neuroprotective histone upregulation response to mitigate DNA and chromatin damage [Cahill et al. DOI:10.3390/Biom14060647].