Basic Information

Symbol
H2AC8
RNA class
mRNA
Alias
H2A Clustered Histone 8 HIST1H2AE H2A/A H2A.1 H2AFA Histone Cluster 1 H2A Family Member E H2A Histone Family, Member A Histone Cluster 1, H2ae Histone H2A Type 1-B/E Histone 1, H2ae Histone H2A/A Histone H2A.2 Histone H2A/M Histone H2AE HIST1H2AB H2A.2 H2AC4 H2AFM
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_021052.4
Sequence length
517.0 nt
GC content
0.5532

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-174.30 kcal/mol
Thermodynamic ensemble
Free energy: -183.39 kcal/mol
Frequency: 0.0000
Diversity: 149.19
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..............(((.(.(((((..((((.(((((.......)))))..)))).(.((((.(.(((((.(.((.(((....((((........))))....))).)))))))).).)))).)((((.((.((..((((((.((((....((((((((..(..(((((....((((((.....))))))((((((((((((.....))))....))))))))........((((((..(((......((((((((.((.(((((...(((..............)))......))))).....))))))))))..........(((.(((((((.....)))))))..)))((((((...)))))).((((((....))))))...)))..)))))).....)))))..)..)).)))).))...)))).)))))).)).)).))))..(((((((.(.(......).))))))))...)))))).)))......((((((....)))))).....
Thermodynamic Ensemble Prediction
......{((((,....(((((((......,..,.}}})))).,}}|}}|,......,(((((((.((({,.(,{(,(((,,,,{(((,.,,....}||}....})).}}}})))}|)||{({{{.((({,({(({{({,((({,(((({{{(((,,({(,,...,{{{....{(((,,,..}}})))))){,|||},,,,,|}}}}},)))}.,,}},)))))},...}}}|{||||,.{{{....{.((((((({,((.,(,(({.,({(,......,......),,....,,,))})}}.,.)))))))))),.........(((.(((((((.....)))))))..)))((((((...)))))).((((((....))))))...,))..)))))).,}))))))).....|{{||||.||{..,....)))}...(((.{({({...,,|||||.}}}...}}})}),))}})))}),)),,,))),......((((((....)))))).....

Transcripts

ID Sequence Length GC content
AUUCUUUUUCUUUAUUCAGUGGAUUGUUAGUUCUUCUGCUGUUAGGAAG… 517 nt 0.5532
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]

Forensic Context

A study in human traumatic brain injury (TBI) patients demonstrated that the H2AC8 was differentially expressed in brain contusion tissue compared to adjacent control tissue, appearing within the Systemic lupus erythematosus signaling pathway identified by KEGG analysis [Yang et al. DOI:10.4103/1673-5374.247467].