| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUUUUUCUUUAUUCAGUGGAUUGUUAGUUCUUCUGCUGUUAGGAAG… | 517 nt | 0.5532 |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]
A study in human traumatic brain injury (TBI) patients demonstrated that the H2AC8 was differentially expressed in brain contusion tissue compared to adjacent control tissue, appearing within the Systemic lupus erythematosus signaling pathway identified by KEGG analysis [Yang et al. DOI:10.4103/1673-5374.247467].