Basic Information

Symbol
H2AZ1
RNA class
mRNA
Alias
H2A.Z Variant Histone 1 H2A.Z H2AFZ H2AZ H2A Histone Family Member Z Histone H2A.Z H2A/Z H2A Histone Family, Member Z H2AZ Histone H2A.Z-1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002106.4
Sequence length
866.0 nt
GC content
0.4469

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-261.90 kcal/mol
Thermodynamic ensemble
Free energy: -278.10 kcal/mol
Frequency: 0.0000
Diversity: 194.17
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((((((((((.((((((((.(.((((.((((((......)))))).)))).)(((((((..((((((((.(((..((((....((.....))....))))))))))))))).))))))))))))(((((.(((........)))..))))).((((.....))))((((((((........))))))))..))).))).))))...............(((((((((((.((((((((((.(((((((((((((...))))))).......(((((((((......)))))))))(((.(((((((...((((......(((.....(((((......)))))....)))...)))).)))))))))).....((((((((((...))))).)))))..(((.......))))))))).))))....)))))).))))........))))))).......(((((.........)))))...(((..(((((((........))).))))..)))...........((((........)))))))))))....)))))))...((((((.(((((.(((.((((.....((((...((.....))))))((((((((((.....))).)))))))......((((((((((((..((((..((((.(((((.((.((((..((((((((...)))))))))))).)).)))))...))))..))))((((((((.(((((...))))).)))..))))).......)))))))))))).......))))...)))))))).)))))).......(((((....))))).............((......))....
Thermodynamic Ensemble Prediction
.,.,,{{(,,(((({,{||||,,,,(((((.(.((((.((((((......)))))).)))).)(((((({..((((((({,(((..((((....((,...,))....))))))))))))))).))))))))))))(((((,(((,,......}||,,}}}}),||((,,,,,||}}{((({(((.,....,.}}|}))}}...{({((({{{(|{,.....}}}|,{..(((((((((((.((((((((((.(((((((((((((...)))))))...,,..(((((((((......)))))))))(((.(((((((...((((......(((.....(((((......)))))....)))...)))).))))))))))..,,,((((((((((...))))).)))))..(((.......))))))))).))))....)))))).))))........))))))).......(((((,{,{....}))),,...(((..(((((((........))).))))..))).............,.})))).}))))))))),}}||{||||},}}||,||||||.,{{,{.,,,.,||||}}},||{,....,...,,||||,.((((((((((.....)))}}))))))...,..(((((((((((({,((((..((((,(((({.((.((((..((((((((...)))))))))))).)).})))).,,))))..)))}{{{{{(((.(((({...})))).)))..}}}}}....,,.))))))))))))...|,..||,|...}}}))))},)))}}}..,.,..|||||...,)}|||{{.|,||,,....}},}.}}}))}...

Transcripts

ID Sequence Length GC content
GCAGUUUGAAUCGCGGUGCGACGAAGGAGUAGGUGGUGGGAUCUCACCG… 866 nt 0.4469
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent member of the histone H2A family that is distinct from other members of the family. Studies in mice have shown that this particular histone is required for embryonic development and indicate that lack of functional histone H2A leads to embryonic lethality. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the H2AZ1 gene was downregulated in lung tissue from sepsis patients as part of the inhibited oxidative stress-induced senescence, telomere maintenance, and epigenetic regulation pathways [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].