Basic Information

Symbol
H2BC17
RNA class
mRNA
Alias
H2B Clustered Histone 17 H2B/N HIST1H2BO H2B.2 H2BFN Histone Cluster 1 H2B Family Member O H2B Histone Family, Member N Histone Cluster 1, H2bo Histone H2B Type 1-O Histone 1, H2bo Histone H2B.2 Histone H2B.N H2B-Clustered Histone 17 DJ193B12.2 H2BFH
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_003527.4
Sequence length
467.0 nt
GC content
0.5782

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-153.00 kcal/mol
Thermodynamic ensemble
Free energy: -160.59 kcal/mol
Frequency: 0.0000
Diversity: 102.38
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((....(((((......)))))((((.......(((.....(((((...(((......((((.......))))....))).))))).......)))........)))).))))))))((....))(((((.((...((((((((((........((((((...(((((...((.(((...(((((.....((((...((....(((((((((.(.((..((.((((((.(....(((.....((((((((((((((((((.((...)))))).)))).))........))))))))...)))...).)))))).))..)).).))))).))))..)).))))))))).))).))..)))))((((((((....)))))...))).........))))))........))))).))))))).)))))............((((((....))))))......
Thermodynamic Ensemble Prediction
.{(((((({....(((((......)))))((((...,...(((.,...(((((...(((......((((.......))))....))).))))).......)))...,....)))).))))))))||,,..||(((((.((...((((((((((........((((((..((((((,..{{..{{,..{{{{|||,.|(({|,,,,...{,((({(((((.{.{{,,{{.({{{{|.{....{|{.....((((((((,{((((((((.((...)))))).)))).},........))))))))...}}}...,.}))))).))..}|,|,|||||,|||}{|{|{{|.,||}},,})}})}..,)))}||||||||.,.,))}}}...})))},)}}}..))))))........)))})}))))))).)))))..}}........((((((....))))))......

Transcripts

ID Sequence Length GC content
AUUCUUGUUAUUUGAGUGCUCUUUCACUCUCCUCCGCCAUGCCCGACCC… 467 nt 0.5782
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]

Forensic Context

A study in humans identified the H2BC17 as one of the top 10 upregulated differentially expressed genes in peripheral blood from myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580].