Basic Information

Symbol
H2BC21
RNA class
mRNA
Alias
H2B Clustered Histone 21 H2B-GL105 HIST2H2BE H2B/Q H2B.1 H2BFQ H2BE Histone Cluster 2 H2B Family Member E H2B Histone Family, Member Q Histone Cluster 2, H2be Histone H2B Type 2-E Histone H2B-GL105 Histone 2, H2be Histone H2B.Q H2B H2B-Clustered Histone 21 H2BGL105 GL105 H2BQ
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_003528.3
Sequence length
2224.0 nt
GC content
0.4793

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-665.10 kcal/mol
Thermodynamic ensemble
Free energy: -703.63 kcal/mol
Frequency: 0.0000
Diversity: 759.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((..(((((.....((((((((...((.((((....((((......))))...........(((((.......)))))........((((((..................)))))))))).)))))))))))))))..)))))))......((((((..((.((.((((((((..(..((......))..)..)))))))).)).)).((((((.((..((((((((((((((((((.(((.....))).((((...(((((((....)))))))...)))).......((((((..((.((.......(((.((.(((....(((((.(((((((.((((((....))).))).)))...)))))))))))))).)))......)).))((((..(((......)))....))))(((((....)))))((((((((((......)))).)))))).)))))).((((((((((((((.....(((((................((((.((((...(((((((((.(((((((.(((((((((((((((((..(((..(((((((..(((.((((((..(((.((.(((((.............(((........))).(((((.((....((((.((((((.......)))))).))))..)).))))).))))).)))))))))))((((.(((((((((((......)))))))).))).))))...((((((.........((((((((((.((((.(((((((..((((((((((..........((((((((((..((((((..((........)).))))))(((((((.......((((((.(((((((.....)))).))(((.((.....))))).(((.((((((.((((...(((......))).)))))))))).)))..(.(((((((...(((((((((.....))).)))))).)))....)))).)..).))))))........)))))))...(((((.((.((((.......)))))))))))...((((.....))))....((((((.((.....))...))))))..(((((....))))))))))))))).......((((((.....((((..((((((..........(((...((((...))))...)))))))))..)))))))))).)))))))))).))))))).....((((....((...(((.....)))...))....)))).........................(((((((((.(.(((((((.(((((((.(((((((..((((.............)))).....))))))).)))))))(((.(((((.(((((((((......(((......(((((((..............(((((((((((...)))))))))))..........(((((((((((...((((....))))..))).)))))))).)))))))..)))..))))))))).)))))))).((((....(((.(((((...((((....))))....))))).)))....)))).)))).))).).)))))))))))))))))).......(((((((...)))))))(((((((..((((.(((((((...(((((((.........))))))).......)))))))))))....(((((.(.......).)))))((((((....((((.(((((((.........(.((....)).)..........)))))))))))))))))............)))))))............)).)))...........))))))......(((.....))).........((((((((........))))))))(((..(((((.(((.....))))))))..))).(((((((....))))))))))..)))))))..))))))))))))))))((.((((((..........))))))))...(((((.......))))))))).))))).))...)))))))))...)))).))))))))))))))))))))))).)))))).)))))))).))))..))..))).)))..((((((((....(((((....)).)))))).)))))..(((((((.((....)).))))))))))))).(((((....)))))((((((.....))))))...
Thermodynamic Ensemble Prediction
...,{{(((,,({((,..{{.((((((((.,,{{.((({....((((......)))}......,,...{({(({{....,)))}}....,...((((((..................))))))})}},)}))))))))}))}),.}))))}|,.....((((({.{(({((.{((((({{.,(,,((,.,,,.||{.|..}||}||||,{{,|,.{{{{{{||||.{{{{{(({{{{{{(({{,.{{{.....|||,{{{{.{{((((((,{{{{..,,,))}}(({((.........,)})),,,.........}}))))))},},,.,,|||{,|||{|||,|||(({||,.|||{.||,}}}..,)),))))||||{...,))})}...}})))||||}..||}}}},,|||{,,,|,|,(((((....))))){{((((((((......)))).))))))||}}}||,(({{{(((((((((...,,{((({.....,,,.....,,|((((.((((.,.(((((((((,(,(((((.((({{((((((((((({..(((..(((((((..(((.{(((((..(((.((.(((((.............(({,{,...||}}},(((((.((....((((.((((((.......)))))).))))..)).))))).))))).}})))}))))|((((.(((((((((((......)))))))).))).)))),.....(((,{{..,{{(((,,,{{{{{|(({{.(({{{{{..,{{((((((({.........,,,{((({(({{((({{{.,((,,....,,||,||||}}{{(((({,,,,,,,({{(((,{{,((({.....||||.{|(((..{,(,,(((||{,(((.{(((((.((((...(((......))).)))))))))).))).|({(((((,({{{({{{{(({(.,.,,|}}.}}}}},.)}}}}.,)))},))})}}})))),,,,,,..}}|||||,.,(((((.(.,((((.......)))))}))))}...,,,,....|}}||,|{.{{{{{{.{|,,,...|,,{||||},..({{{{....))})),||,,,|||}||.....||{|||....,{(((,,((({((,...,,,,,.{({...((((.,,|}}}.,,)})})))}),,)))))})))),))))))}}}}.)))},}},,,,,|||{,...||,,.{||,.,,})))....)},.,,.}}}}||..|.,,)}}............,,,,,,{|{,|,||{||||.|||||||,{{{{|||,,||||,,.,,||,...},}}))),,,,))))))),)))))))||||{{{{{.{(((({{{{......{({......{(((({|....,,,,,...,.{((((((((((...))))))))))}..........(((((((((((...((((....)))).,))).)))))))).}}}}|||,,|||,,}}}}}}}||,}}}}})))}{{{{..,,|||,|||{{...{{{{....}))}....})))}.)))....)))),||}),)),...))}))))))))))}|||,,{{{{....|}}}}.,,}||||||((((({({..,,((((,(((,.,,(((((((,,...,...}}|}}}}.......|||{{{{.....}}}}}}}{.{||.,|||,.}||||((((((....((({{(((((((.........,,((....)).)..........)))))))))))))))}}..,,,.,.....}}}}}|}...||}}...,}})}))},,,}......,))}}))}}},,.,{|},..,)))},,,,,...((((((((........)))))))){({..(((((.(((.....))))))))..}}}.{{(((({....|)))))})}}..)))))))..))}}))))))))))))((.((((((..........))))))))...(((((.......)))))}))).))))).))...))))))))).,,)))).))))))))))))))))))))))),))}}}},}}||||||.,})),}))..,}|||}|||{||{{,,...,,{|{,||..,|},,}},,.,}))),..{(((({(.{{....)}.))))))))))))).,,,{|....,}}},,{{{,,.....,,,,,,...

Transcripts

ID Sequence Length GC content
ACUUCUUUUCUUGGCUAAGCCGCGUUUGUACUGUGUCUUACCAUGCCUG… 2224 nt 0.4793
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif. The protein has antibacterial and antifungal antimicrobial activity. [provided by RefSeq, Aug 2015]

Forensic Context

A study in humans identified HIST2H2BE as a top hub gene with dramatically elevated expression in sepsis patients compared to healthy controls [Yu et al. DOI:10.1016/j.heliyon.2023.e15034].