Basic Information

Symbol
H2BC4
RNA class
mRNA
Alias
H2B Clustered Histone 4 H2B/L HIST1H2BC H2B.1 H2BFL Histone Cluster 1 H2B Family Member C H2B Histone Family, Member L Histone H2B Type 1-C/E/F/G/I Histone Cluster 1, H2bc Histone 1, H2bc Histone H2B.1 A Histone H2B.L Histone H2B.A Histone H2B.G Histone H2B.H Histone H2B.K DJ221C16.3 HIST1H2BE HIST1H2BF HIST1H2BG HIST1H2BI H2BC10 H2BC6 H2BC7 H2BC8 H2BFH H2BFG H2BFA H2BFK H2B/A H2B/G H2B/H H2B/K
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden death from CNS diseases Mechanical injury analysis

MANE select

Transcript ID
NM_003526.3
Sequence length
460.0 nt
GC content
0.5587

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-151.20 kcal/mol
Thermodynamic ensemble
Free energy: -159.76 kcal/mol
Frequency: 0.0000
Diversity: 56.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........(((((..((((((((..((((.((......))))))..((((.......))))........(((.(((......((((...................))))...))).)))((..((((.((((((..(.((..((((((..((((.((.....(((((...(((((.((((.(((((((...(((..((((.....(((((....)))))...........((((((((((((((((((.((...))))))).))).))........))))))))))))..)))...)))))))))))(((((.(((((((.(((.(((....)))))).)))...))))))))))))))..)).))).....)).))))..))))))..)).)..))).))).))))..))..)))))))))))))..........((((((....)))))).....
Thermodynamic Ensemble Prediction
...........(((((..{(((((((.,,,((((,.....{||||,}..((((.......))))........(({.{,,.,....|{||}}}.......}}}}.....|||}..,)}}.}}}||..((((.((((((..(.((..((((((..((((,{(.....(((((.{,(((((.((((.(((((((...(((..((((.....(((((....)))))...........((((((((,{((((((((.((...))))))),})).,,........))))))))))))..)))...)))))))))))(((({,(((((((.(((.(((....)))))).)))...)))))))))))))),,)).))).....}).))))..))))))..)).}..))))}}).))))..,,..)))))))))))))..........((((((....)))))).....

Transcripts

ID Sequence Length GC content
GACACAUUUCUGGUGUUUUAAGAUGCCUGAGCCAGCCAAGUCUGCUCCC… 2378 nt 0.3780
GACACAUUUCUGGUGUUUUAAGAUGCCUGAGCCAGCCAAGUCUGCUCCC… 460 nt 0.5587
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. The protein has antibacterial and antifungal antimicrobial activity. The main transcript variant of this gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. This transcript variant lacks a polyA tail but instead contains a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Apr 2020]

Forensic Context

A study in humans demonstrated that the H2BC4 gene, associated with telomere maintenance and epigenetic regulation, was downregulated in lung tissue from post-mortem samples of septic shock patients as part of inhibited telomere maintenance and epigenetic regulation pathways [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in humans with traumatic brain injury (TBI) identified the H2BC4 as a differentially expressed mRNA appearing in the Systemic lupus erythematosus KEGG pathway [Yang et al. DOI:10.4103/1673-5374.247467]. In a separate study in mice, the protein Histone H2B type 1-C/E/G (Hist1h2bg) was found to directly interact with the lncRNA Gm18840 in HL-1 cells, as identified by RNA pulldown and RIP-qPCR [Luo et al. DOI:10.3389/fcell.2021.615950].