| ID | Sequence | Length | GC content |
|---|---|---|---|
| GACACAUUUCUGGUGUUUUAAGAUGCCUGAGCCAGCCAAGUCUGCUCCC… | 2378 nt | 0.3780 | |
| GACACAUUUCUGGUGUUUUAAGAUGCCUGAGCCAGCCAAGUCUGCUCCC… | 460 nt | 0.5587 |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. The protein has antibacterial and antifungal antimicrobial activity. The main transcript variant of this gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. This transcript variant lacks a polyA tail but instead contains a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Apr 2020]
A study in humans demonstrated that the H2BC4 gene, associated with telomere maintenance and epigenetic regulation, was downregulated in lung tissue from post-mortem samples of septic shock patients as part of inhibited telomere maintenance and epigenetic regulation pathways [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938]. A study in humans with traumatic brain injury (TBI) identified the H2BC4 as a differentially expressed mRNA appearing in the Systemic lupus erythematosus KEGG pathway [Yang et al. DOI:10.4103/1673-5374.247467]. In a separate study in mice, the protein Histone H2B type 1-C/E/G (Hist1h2bg) was found to directly interact with the lncRNA Gm18840 in HL-1 cells, as identified by RNA pulldown and RIP-qPCR [Luo et al. DOI:10.3389/fcell.2021.615950].