Basic Information

Symbol
H2BC9
RNA class
mRNA
Alias
H2B Clustered Histone 9 H2B/J HIST1H2BH H2BFJ Histone Cluster 1 H2B Family Member H H2B Histone Family, Member J Histone Cluster 1, H2bh Histone H2B Type 1-H Histone 1, H2bh Histone H2B.J H2B-Clustered Histone 9
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_003524.3
Sequence length
462.0 nt
GC content
0.5541

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-141.30 kcal/mol
Thermodynamic ensemble
Free energy: -150.30 kcal/mol
Frequency: 0.0000
Diversity: 152.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((.......(((.((..(((..((......))..)))..))...))).......))))))))))((((((((..(((((((((((((...(((...((.((((((...((.((((((((.(((.((..((.......))..)).))).)))))))...((((((((......(((......)))..)))))))).(((((......)))))..).))...)))))).))...(((....((((((((...(((((((.((...)))))).)))............))))))))..)))..(((((((.((...(((.(((.(....).)))))))).)))))))....(((.......)))(((((....)))))....)))))))))..(.(((...((((((......)))).)).))).)..........)).)))))..))))).))).
Thermodynamic Ensemble Prediction
.,((((((((((({{....,({((,..(({{{(,{,...{{{{|,,..||,...||{.|{{..,{{({,......)))}....,|,.|||||||,,..}}||||}|}||}}|||{((({,{{{(((((.(((,,{..{{..{{{{.,,..))}))}.}}))))),,.{(((((((..,...(({......}})..)))))))|,(,(({......}))))|........,}}}}}}}},..|,,....((((((((...(((((((.((...)))))).)))............))))))))..|,,..{,{{{||,||..,(((.((({.,..,,.}}))}))),}))))||,.,{(((.......)))}||}},{{.|||......))).))....,))))))|.((((((......)))).)).,,......,))))}{(((({....}))))).....

Transcripts

ID Sequence Length GC content
ACUUUGGGGUGUAUUCUUACUCCUUUAUCUUGUUGCAAUGCCUGAUCCA… 462 nt 0.5541
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]

Forensic Context

A study in human neuroblastoma (SH-SY5Y) cells demonstrated that manganese exposure induced a 4.20-fold upregulation of the H2BC9 as part of a neuroprotective histone response to mitigate DNA and chromatin damage [Cahill et al. DOI:10.3390/Biom14060647].