Basic Information

Symbol
H3-3B
RNA class
mRNA
Alias
H3.3 Histone B H3.3B H3F3B H3 Histone, Family 3B (H3.3B) H3 Histone Family Member 3B Histone H3.3 H3 Histone, Family 3B BRYLIB2 H3.3A H3F3A H3F3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_005324.5
Sequence length
2705.0 nt
GC content
0.4307

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-806.90 kcal/mol
Thermodynamic ensemble
Free energy: -859.24 kcal/mol
Frequency: 0.0000
Diversity: 732.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((((((((((.(.((((...((((.((.....((((((((((((((((((((.(.(((((.(.....).))))).).))))).(((((......))))).......))))))...)))))))))..)).))))))))..).))))))))))..........(((.(((.....)))))).......(((((..(....)..))))).....)))))).((.((.(((.(((((......))))).))).)).))(((((....)).)))((((((((((.(((((((...........))).)))))).(((((((((((((((((...((..((((((((....((((((......))))))...))))))))..))((((.(((((.(.(((((((((((((((((....)).))..)))))))).))))).).)))))))))..........(((((.....))))).(((((((((((........((((..........))))(((.(((....))).)))...(((((.(((((...((((..(((((.((.....)).)))))..))))....))))).))))).....)))))))))))(((((.(.((((....)))).).)))))...((.(((((((((...((((((......))))))((((((...(((.(((((((((((..((((......))))((((((.((.((((...(((((((((.(((((((((((((..(((.((.((..............)).)).))).))))))))))))).))))))))).((((.((....)).))))............((((((((((((((((.((.(((((((.((((((.((((((((((((.(((...))).))))....))))))))))))))......((((((.(((((((.((((((...(((((((((((((....)))))...)))((((((..(((.((((.((........................)).)))).)))..))))))(((((((.......((((.(((((((.((((((((....(((((((.......)))))))((((((.(((...((((((.((...)).))))))..))).))))))....((((.(((((((.......))))))).))))...)).)))))))))))))))))))))))).....)))))...)))))).))))))).)))).))....(((((((...................))))))).))))))))).))))))))).....................(((((((((((((((((..((((((((.....((((((..(((..(((((((.......(((((((.(((((.((((((((((......(((((....)))))........(..((((((....((((((((.((((((((((...(((..((.(((((((.((((.......))))((((((....((((((........))).)))..))))))......(((.(((...((((((((.(((((...))))).))).)))))....))).))).....(((((((....)))))))..(((((((.......)))))))...((((.(((((((.((.((((((((.(((((....(((.((((.....(((((..((((((((..((((............................))))...))))))))..))))).)))).)))))))))))))))).))....))))))).)))).((((((((((.(((((.......((..(((.........))).)).......)))))...)))))))))).((((..((.(((((..........)))))))))))))))))).)).)))..)))))))))).).)))))))...))))))..).))).))))).))))))).))))))).......))))))).)))))))))((((((((..(.(((.(((((((.(((.((.((.....)))).)))..(((((.((..((((((((((((((((....(((((((((.................))))).....))))....)))))))))))))))))).)))))...((((((((.......)))))))).((((((.(((....((((((.....)))).))..))).)))))).(((((((((((..(((.......)))))))))).)))).))).))))))).))))))))))))))))))).)))))))..)))))))).(((((((((...))))))))).((....))..)))))))..)))))).))))))...(((.(((....))).)))..))))))..((((....))))....((((.((.((((((((((((....))))))...)))))).))))))......((.(((((........))))).))))))).)))))))))........))))))))).)).(((((..((((((.......)))))))))))..)))))))))).....(((....)))....((((((((.((((......(((..((.....(((....)))....))..))).....)))).))))))))..)))))))..............))))))))...
Thermodynamic Ensemble Prediction
,,{{{{.((((((((((.(.({{{..,((((.((.....(((((((((({((({(((((,(,(((((.(.....).))))).),)))})}|||||,.{,,{|,,,,....,}}))}}}..,})))))))))..)).))))))))..}.)))))))))),...{{{{,,(((.(((....,))}))|,......(((((..{....)..))))).....))||||{{{{{{{{((.((((({..{{{|||||.}||{|{{.{({{,{...,))})))|{{{{({{{{.{{{((({........,,.)))}})))}},|||{{({((((((((((,,,||..((((((((....((((((......))))))...)))))))).,)){{{{.(((((.(.(((((((((((((((((....)).))..}))))))).))))).}.))))),,}},..||,,,,.({(((.....)}))).,{({(((((((......{,({{,.{.{,,,,,,||}}(((.(((....))).)))...({(((.(((({...((((..(((((.((,...,)).)))))..))))....}}))).))}}}....,|||||}}}},|(((((,,.,,,.,}}}))),.,,)))))...{{|{({||{|((,,.((((((......))))))|||{{,..,|{{.{{(((((((((..((((......))))((((((.((.((((..,(((((((((.((((((((((((({{(,(,{,.,..,,,,,{{{.{{..,,}),}))}.})))))))))))).})))))))),((((.((....)).))))............{(((((((((((((((.((.(((((({.((((((.((((((((((((.(((...))).)))),...})))))))))))))......{,((((.(((((((.((((((...(((((((,(((((....))))).}}},,((((((..{{{.((((.((........................)).)))).})}..)))))){((((({,.....,{(((.(({{{{{.{{{{|||{....(((((((.......)))))))((((((.(((..,((((((,{,..,)).))))),..))).))))))....((((.(((((((.......))))))).)))),..,,,}|||||}}}}}})))))))))))}.....))))).,.)))))).))))))).)))).),....(((((((.,,.............,,.))))))).})))))))).))))))))).........,,,,..}}}...((((((((((((((({(..((((((((.....((((((..(((..(((((((,....{.{{(((((.(((({,((((((((((......(((((....)))))......,{.(,{(((((....((((((((.((((((((((...(((..((.(((((((.((((.......)))){(((((,...((((((........))}.))),.)))))|||||,.{{{.{{{,..{{,,{{{{((((..{(((({|....)})))))..}})),,||||,...,,{{,||,,,.|}}|}||,.(((((((.......))))))),,,|||{.{{,{{,,.{{.{((((((|{(((((....(({.((({....,(((((..((((((((..((((,..,,.......,||.....,.......})))...)))))))).,))}}},)))).}))))))))))))))),}}..,,}}}}))}.}})}}|||{{(((((.((({(,.....,((,.|||}}.......}}}.)},......}}||}...,},)))))))|||||..{{.{((((.|,....,,.))))}}}}))}))))))).)).)))..)))))))))).)})))))))...))))))).),))},}}))).))))))).)))))},.}....,))))))).))))))))}{(((((((.,(,(((,((({{((,(((.((.((.....)))).))).}||,,|,||,,|||||{(((({{{(((,,,,|||,,,|||,................||||},,,,,}}}},}}})}})))}}}})))})),..}))))},,((((((({......,}))}}}||,(((({(,((,{({,((({((..,,,|||}.}},.},,.}))})}.{|||||||||,.}|||,,,.,,,))}))))))).}})).}))}}}})))).}))))))))))))))))}}.)))))))..)))))))).{((((((((...))))))))).{{....},..))))))}..)))))).))))))...(((.(((....))).)))..)))))},.{(((....)))),...((((.((.((((((((((((....))))))...)))))).))))))......{{.(((((........))))).))))))).))))))))}......,,)})))))))},}|(((((.,((((((.......)))))))))))..)))))))))).,...|||..,,)))}}}}||{|||{{.,|||||{,.{(((.{(({.....(((..{{|,...}))..))).....)))).))))))}}.,))})},|||{.,{{......}})),.})),..

Transcripts

ID Sequence Length GC content
GAGCGCAGAGCGGUUUGGUCGUUCGUUGGGCGGUGCUGGUUUUUCGCUC… 2705 nt 0.4307
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded by this gene is a replication-independent histone that is a member of the histone H3 family. Pseudogenes of this gene have been identified on the X chromosome, and on chromosomes 5, 13 and 17. [provided by RefSeq, Oct 2015] CIViC Summary for H3-3B Gene

Forensic Context

A study in humans demonstrated that postmortem midbrain analysis of chronic cocaine abusers identified the H3-3B transcript as significantly upregulated 1.5-fold and diagnostic for cohort assignment [Bannon et al. DOI:10.1038/Npp.2014.70].