Basic Information

Symbol
H3C10
RNA class
mRNA
Alias
H3 Clustered Histone 10 HIST1H3H H3F1K H3/K H3FK Histone Cluster 1 H3 Family Member H H3 Histone Family, Member K Histone Cluster 1, H3h Histone 1, H3h Histone H3.1 Histone H3/K H3FC HIST1H3C Histone H3/A Histone H3/B Histone H3/C Histone H3/D Histone H3/F Histone H3/H Histone H3/I Histone H3/J Histone H3/L HIST1H3A HIST1H3B HIST1H3D HIST1H3E HIST1H3F HIST1H3G HIST1H3I HIST1H3J H3C11 H3C12 H3C1 H3C2 H3C3 H3C4 H3C6 H3C7 H3C8 H3FA H3FL H3FB H3FD H3FI H3FH H3FF H3FJ
Location (GRCh38)
6:27810051-27811300
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Mechanical injury analysis Postmortem interval inference
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_003536.3
Sequence length
486.0 nt
GC content
0.6111

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-192.70 kcal/mol
Thermodynamic ensemble
Free energy: -201.69 kcal/mol
Frequency: 0.0000
Diversity: 162.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
............((((((((((.(((((((......((((...))))((((((((....((.(((..((((..((....)))))).))).))..((((.(((....)))))))..((((...(((((((...........)))))))...))))((((..((((((((((...))))...))))))))))(((((((((((.((.(((((..((........))..))))))).))))(((((....))))).)))))))......))))))))((((.((((((((((((((..(((..((((.......))))..)))))))..))))))))))..))))(((......))))))))))))..(((....(((((...((((.((((..((....))..(((((.((.((....))))))))).)))).(((((((...))))))).))))....)))))...)))....))))))))......
Thermodynamic Ensemble Prediction
...{,,......((((((((((.((((((({,,((.,(({...|)))}}..,{,,,.{{({,(({..((({..((,,..}}}}||,|||.},..{|,||(,(|{..}.}}})}}}}))).))||,(((((((((,{(((((((((.....((((({((,,(((((((({{.,,|}}}.,,))}||}....{,|||{,.,,}}|}}|||||,.|,...,,{{{||{{||||||{{}|,((((,({{.{|||||{||,},||......},))))))}.....)},)}}}))),)...))))))).)))))))},)).)))))....))))))))))))),,..)))}))..,,,}))))))))))..(((....(((((...((((.((({..((....)).,((({(.((,((....,))))))}).)))),(((((((...))))))).))))....)))))...)))....))))))))},,...

Transcripts

ID Sequence Length GC content
NM_003536.3 NCBI
GAAGUGAAUCUAGCUCUGAAGGCAUGGCGCGUACGAAGCAGACUGCUCG… 486 nt 0.6111
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]

Forensic Context

A study in mice demonstrated that the H3C10 gene exhibited a significant increase in expression (3.18 log2 fold) in peripheral whole blood from juvenile animals following controlled cortical impact traumatic brain injury compared to sham controls [Hazy et al. DOI:10.1038/s41598-019-45089-z]. This finding was part of a broader transcriptomic analysis revealing a distinct, age-dependent peripheral immune response to brain trauma. A study in mice demonstrated that the H3C10 transcript, a core histone gene, increased in abundance within 0.5 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].