Basic Information

Symbol
H3C15
RNA class
mRNA
Alias
H3 Clustered Histone 15 HIST2H3A H3/N H3/O Histone Cluster 2 H3 Family Member A H3-Clustered Histone 13 H3-Clustered Histone 14 Histone Cluster 2, H3a Histone 2, H3a Histone H3.2 Histone H3/O H3-Clustered Histone 15 Histone H3/M HIST2H3C HIST2H3D H3C13 H3C14 H3F2 H3FM
Location (GRCh38)
1:149852608-149853125
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Mechanical injury analysis Other applications
External database
HGNC NCBI Ensembl UniProt GTEx

MANE select

Transcript ID
NM_001005464.3
Sequence length
518.0 nt
GC content
0.6525

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-222.00 kcal/mol
Thermodynamic ensemble
Free energy: -231.55 kcal/mol
Frequency: 0.0000
Diversity: 156.70
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((.((((((((((((((((((..((.((((....((((.(((.(((......)))))).))))...)))).))..))))))(((...)))........)))))(((((.....((((((.(....).)).)))))))))..))))))).))))))((((.(((((((((((((.(((.(((((....)))))..((((..(((.((((((..((....((.((.(((........))).)))).....))..)))))))))..))))(((((((.((.......)).))))))).......))).))))).((((((((.(((((((.((.((.(((....))).)).)).)).((((......)))))))))))))))))(((((.....)))))..............((....))((((.((.(.((((....)))).).)).))))......)))))))).)))).(((............)))....((((((....)))))).....
Thermodynamic Ensemble Prediction
.((((((.(((((((..((.((((((..(({({((,...(({{((((.((({{........||{(,(({{{..|..,||,.,{((|{{{...))),)),}..,)))))})))}}....)))))))|))},}.))..))))))))..))))))).))))))((((.((((((((,((({{{|{.|,(({||..,||}|{.,,{|}.|||}|||{,{..,({{{{(((((.((.,....{{.|||{|},..,,,.},|||||||||||,.}}}}(((((((.({.......)).))))))).......(((.(({{((((((((((.((((((({((.{{.{||,,,.))).}}.}),}}{((((......))))))))))))))))}}))))).)))||||||,,,,,}}))}...|||,.,||,|||||,|{||,||.|||}}}},..})))))}......)))))))}.)))).|||.,.,},......,,,....((((((....)))))).....

Transcripts

ID Sequence Length GC content
NM_001005464.3 NCBI
GUUUUUCUCCCCGCCGCUGCGCUGGUAAGCCUGUGUUUUGGUUCGCUAU… 518 nt 0.6525
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Aug 2015]

Forensic Context

A study in human trauma patients demonstrated that the H3C15 mRNA was significantly downregulated in circulating CD3+ T cells during the injury stage compared to the recovery stage [Rau et al. DOI:10.2147/JIR.S375881]. This finding was part of a broader interactome where 58 mRNAs were downregulated and 9 miRNAs were upregulated following major trauma, with pathway analysis indicating a predominant involvement in chemokine signaling.