| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUUUUCUCCCCGCCGCUGCGCUGGUAAGCCUGUGUUUUGGUUCGCUAU… | 518 nt | 0.6525 |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Aug 2015]
A study in human trauma patients demonstrated that the H3C15 mRNA was significantly downregulated in circulating CD3+ T cells during the injury stage compared to the recovery stage [Rau et al. DOI:10.2147/JIR.S375881]. This finding was part of a broader interactome where 58 mRNAs were downregulated and 9 miRNAs were upregulated following major trauma, with pathway analysis indicating a predominant involvement in chemokine signaling.