| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUGCAUUUUGUUUAGUACAAGACAUGUCUGGGCGCGGCAAAGGCGGGA… | 387 nt | 0.5633 |
Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]
A study in zebrafish and mouse demonstrated that the H4C13 transcript, a core histone, increased in abundance at 4 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267].