Basic Information

Symbol
H4C13
RNA class
mRNA
Alias
H4 Clustered Histone 13 H4/K HIST1H4L H4.K H4FK Histone Cluster 1 H4 Family Member L H4 Histone Family, Member K Histone Cluster 1, H4l Histone 1, H4l Histone H4 H4-16 HIST1H4A HIST1H4B HIST1H4C HIST1H4D HIST1H4E HIST1H4F HIST1H4H HIST1H4I HIST1H4J HIST1H4K HIST2H4A HIST2H4B HIST2H4 HIST4H4 H4C11 H4C12 H4C14 H4C15 H4C16 H4C1 H4C2 H4C3 H4C4 H4C5 H4C6 H4C8 H4C9 H4/A H4FA H4/I H4FI H4/G H4FG H4/B H4FB H4/J H4FJ H4/C H4FC H4/H H4FH H4/M H4FM H4/E H4FE H4/D H4FD H4/N H4F2 H4FN H4/O H4FO
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_003546.3
Sequence length
387.0 nt
GC content
0.5633

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-142.30 kcal/mol
Thermodynamic ensemble
Free energy: -149.09 kcal/mol
Frequency: 0.0000
Diversity: 103.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.....((((((.(((.....))))))))))))))...((((((((((((((((((...(((.(((((.((((((..((((......))))............((((........))))....(((.(((((......)))))))))))))).))))).)))...)))).......(((((..(.((((((((((((.(((....))).))))))....))))))....(((.....((((..(((.((((((...............((((((((..(((((((..((((....))))..)))))))..))...)))))))))))))))..))))...))).........)..)))))..)))))))))))...))).....
Thermodynamic Ensemble Prediction
,((((....{((((((.(((.....)))))))))),})),,.{{{(((((((((((((((...(({,(((((.{(((((.|((({......}))}.|..........((((........))))....(((.{((((......)))))))))))))).))))).})),..)))).......((((({.(,((((((((((((.(({....))).))))))....)))))).,}.,({.....{{,,,,({(.(((((,,.{{......,,,..{||,,|||.,|||{||{..((((,,,.}|||{{||||||},,,,.}}.)))))))))))}})}}))))...,,...,......,,})))))..})))))))))).||))).}}}.

Transcripts

ID Sequence Length GC content
GUUGCAUUUUGUUUAGUACAAGACAUGUCUGGGCGCGGCAAAGGCGGGA… 387 nt 0.5633
Summary

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]

Forensic Context

A study in zebrafish and mouse demonstrated that the H4C13 transcript, a core histone, increased in abundance at 4 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267].